homework help

Genetics as it applies to evolution, molecular biology, and medical aspects.

Moderators: Leonid, amiradm, BioTeam

Post Reply
mini-c
Garter
Garter
Posts: 2
Joined: Tue Nov 21, 2006 5:10 pm

homework help

Post by mini-c » Tue Nov 21, 2006 5:14 pm

I am trying to complete an online lab only course and am finding it difficult. Hate to ruin my GPA over this.
Genetics: We are asked: informational or template sequence, how can we tell, and what is the name of the protein. I can't find this information in my reading. What am I missing?
Thanks,

User avatar
LilKim
Coral
Coral
Posts: 436
Joined: Mon Mar 20, 2006 8:36 pm
Contact:

Post by LilKim » Thu Nov 23, 2006 6:23 am

hmm.. i'mnot sure if i'm understanding your question... could you please expand or re-explain it... and i'l try to help

- kim

mini-c
Garter
Garter
Posts: 2
Joined: Tue Nov 21, 2006 5:10 pm

lab

Post by mini-c » Mon Nov 27, 2006 8:15 pm

The sequence is AAGATTAGTAGTACGACAATC
Is this informational or template?
How can I tell?
What does my conclusion mean in terms of determining the name of the protein?
I have to take the online lab only and I can't seem to make sense out of this.
Thanks,

User avatar
Dr.Stein
King Cobra
King Cobra
Posts: 3501
Joined: Thu Jul 07, 2005 7:58 am
Location: 55284 Yogyakarta, Indonesia
Contact:

Post by Dr.Stein » Tue Nov 28, 2006 8:55 am

The key it "T" Only DNA that has the "T" thingy, so...? ;)

For the protein name, there is a fix table for matching the codon with the triplet code for the amino acid brought by tRNA.
Image

Post Reply

Who is online

Users browsing this forum: No registered users and 2 guests