Transcription & Translation

Discussion of all aspects of cellular structure, physiology and communication.

Moderators: Leonid, amiradm, BioTeam

Post Reply
cobalamin
Garter
Garter
Posts: 5
Joined: Sat Aug 26, 2006 12:44 pm

Transcription & Translation

Post by cobalamin » Tue Nov 14, 2006 11:15 am

Hi, I'm reading on some concepts involving protein synthesis. I was doing some practice problems from my biology book which involves transcription and translation. I was wondering if anyone here may please check over my work. Thank You.

Question: Suppoe you have the following original strand of DNA (5' is on the left and 3' on the right)

Code: Select all

AAAAAAATGGGCCCGGGAGCATAAAATGAATTTTTTTTTAAAATA

(i) What is the nucleotide on the 5' end of the template strand?
a) AAAAAA
b) TTTTTT
c) ATAAAA
d) TATTTT
e) UUUUUU

This just means writing down the complementary base pairs to get the template strand so:

Code: Select all

3' TTTTTTTACCCGGGCCCTCGTATTTTACTTAAAAAAAAATTTTAT 5'

Looking at the 5' end of the tmplate strand, we have d) TATTTT

(ii) What is the sequence on the 5' end of the normal mRNA?
a) AAAAAA
b) TTTTTT
c) AUAAAA
d) UUUUUU

Do I look for the "TATA box" on the template strand and then the first 6 bases would be the sequence on the 5' end of the mRNA? so c) AUAAAA

(iii) What is the sequence of the mRNA for the normal gene?
a) AAAAAAAUGGGCCCGGGAGCAUAAAUGAAUUUUUUUUUAAAAUAAAA
b) AUGGGCCCGGGAGCAUAAAAUGAAUUUUUUUUUAAAAUAAAA
c) AUGGGCCCGGGAGCAUAA
d) AAAAAAATGGGCCCGGGAGCATAAAATGAATTTTTTTTTAAAATAAAA

The answer to this should be the original coding strand but with the thymine replaced with uracil, correct? so a)

(iv) What is the first anticodon that will appear at the ribosome for the normal gene?
a) AUG
b) AAA
c) UAC
d) UUU

Well the first start codon is usually AUG, so the anticodon should be UAC, so c) UAC?

I would greatly appreciate it if anyone could please help me with these. Thank you.

sdekivit
King Cobra
King Cobra
Posts: 586
Joined: Sat Jul 30, 2005 7:16 pm
Location: holland
Contact:

Post by sdekivit » Tue Nov 14, 2006 8:10 pm

the first triplet recognized by tRNA doesn't necessarily have to be a UAC, coding for methionine. Also valine can be used in rare cases as the start codon.

Post Reply

Who is online

Users browsing this forum: No registered users and 4 guests