Can some one help me with these Molecular Biology questions?

Discussion of all aspects of biological molecules, biochemical processes and laboratory procedures in the field.

Moderators: Leonid, amiradm, BioTeam

Post Reply
magecraft
Garter
Garter
Posts: 3
Joined: Mon Oct 16, 2006 9:37 pm

Can some one help me with these Molecular Biology questions?

Post by magecraft » Mon Oct 16, 2006 9:38 pm

Hello, i am studying Molecular Biology and i am seeking help with a few fundemental concepts in Molecular Biology. My Friends have suggested the Bioforum because this is a good community of people interested in Molecular Biology. Any help you can provide is greatly appreciated.

1] The first concept is, ok lets say i have a sequence "TAATCGAATGGGC"

How would i go about deriving different protein sequences from that sequence? Are protein sequences 3 bases in length? Can you help me derive 3 protein sequences from that sequence?


2] if i have a gene and the direction of transcription like this,

--------------------->
5' -- ATGATACCGACGTACGGCATTTAATACTATGGCTGCATGCCGTAAATT --3'


How can i find the sequence of the corresponding antisense strand and the mRNA?
Also, how can i fidn the sequence of the resulting protein?


3] If i have a protein sequence LMK (L= leucine, M= methionine, K= Lysine) how many dna sequences could give rise to it?


4] How would i show a digestion sequence for the restriction enzymes BamH1 and HindIII. What would the "Sticky ends" look like?


5] If i have a DNA molecule of length 40,000bp and digest it with a 4-base cutter restriciton enzyme (the enzyme recognizes a 4bp sequence). Assuming a random distribution of bases in the DNA molecule, statistically, how many pieces/fragments can we get when the DNA molecule is digested with the restriction enzyme?

this is the quesitons i have, any responses is much appreciated.

oppox
Death Adder
Death Adder
Posts: 96
Joined: Sat May 13, 2006 11:20 am
Location: Sweden

Post by oppox » Mon Oct 16, 2006 10:53 pm

1. yes its 3 and its called a codon also search the word reading frame.

2. antisense strand is the other strand in a double DNA strand.

3. see 1, search for codon table, for an example look in wikipedia.

4. search for BamH1 and HindIII at http://www.novagen.com

these questions arent hard to find the answers to if u look on the internet or in a textbook, I gave u some keywords.

goodluck

magecraft
Garter
Garter
Posts: 3
Joined: Mon Oct 16, 2006 9:37 pm

Post by magecraft » Mon Oct 16, 2006 11:50 pm

ty for the reply, any ideas on question 5?

also so can you help me with question#1 to derive 3 sequences?

User avatar
canalon
Inland Taipan
Inland Taipan
Posts: 3909
Joined: Thu Feb 03, 2005 2:46 pm
Location: Canada

Post by canalon » Tue Oct 17, 2006 1:45 am

5-Calculate the probability to have a given sequence of 4 bases (the recognition site) multiply by the length of your DNA et voilà.

3- find a codon translation table (type those 2 words in google) and do your homework.
Patrick

Science has proof without any certainty. Creationists have certainty without
any proof. (Ashley Montague)

magecraft
Garter
Garter
Posts: 3
Joined: Mon Oct 16, 2006 9:37 pm

Post by magecraft » Tue Oct 17, 2006 2:04 am

ok so 1/4 to the fourth power right..so its 1/256


1/256 times 40,000 = 156.25

answer is 156 pieces and 1 fragment?

Post Reply

Who is online

Users browsing this forum: No registered users and 6 guests