Can I evolve from any species?

Discussion of everything related to the Theory of Evolution.

Moderators: honeev, Leonid, amiradm, BioTeam

Post Reply
Posts: 4
Joined: Sat Apr 29, 2006 6:41 am

Can I evolve from any species?

Post by marsh8472 » Sat Apr 29, 2006 6:48 am

Let's say I had a population of some species let's say cockroaches.. and I had a computer that would analyze their dna and compare it to my own. The computer computes a number that tells me how similar my dna is to each of theirs. Anyway, now lets say I keep killing off the cockroaches that resemble my dna the least. Theoretically over time, will I eventually end up with a genetic clone of myself matching my dna perfectly? In which case, my clone evolved from a cockroach. They are given infinite time to turn into a human in the experiment. I've had long discussions about this at other places and we haven't been getting anywhere so if there are any experts in evolution and genetics we could sure use your help :-) Also another condition to add is that the experiment could be run on an infinite number of populations simultaniously ensuring that any evolutionary route that can happen, will happen (if it's necessary).


Posts: 2
Joined: Sat Apr 29, 2006 4:06 pm

Post by Darwinn » Sat Apr 29, 2006 4:10 pm

I believe that you would run into a number problems doing this. First off, cockroaches do not have the same number of chromosomes as humans so that would be a problem, and chromosome reduction usually causes sterility or death.

Also, different species share most of their DNA in common with one another, so the big challenge for you would lie in the Hox genes. These genes control how different body segments grow and develop, so you would have to correctly modify the expression of these genes so that the cockroach would develop into a human. Another problem would lie in making the cockroaches into mammals.....

I would say that it would be extremely difficult for you to turn a cockroach into a genetic clone of you, but theoretically its possible...

Posts: 4
Joined: Sat Apr 29, 2006 6:41 am

Post by marsh8472 » Sat Apr 29, 2006 7:16 pm

notice that word "usually causes" and since we have an eternity it should not be a problem to reduce the 27 pairs of chromosomes in a cockroach to 23 over time. Trillions of years at least mind you, but it still shouldn't be a problem. Mutations allow the addition, removal and modification of dna so it would simply be a matter of adding/removing/modifying the cockroach gene pool until it became human.

User avatar
Inland Taipan
Inland Taipan
Posts: 5345
Joined: Thu Jan 20, 2005 8:14 pm
Location: Nashville, TN

Post by mith » Sat Apr 29, 2006 11:16 pm

kinda reminds me of the red dwarf tv show where they had a cat evolve into a human.
Living one day at a time;
Enjoying one moment at a time;
Accepting hardships as the pathway to peace;

User avatar
Posts: 11
Joined: Sun Apr 23, 2006 8:34 pm

Post by Leben » Sun Apr 30, 2006 12:36 am

To bad that we do not have a trillion years.

User avatar
King Cobra
King Cobra
Posts: 5599
Joined: Fri Dec 23, 2005 4:50 pm
Location: South Louisiana (aka Cajun Country)

Post by alextemplet » Sun Apr 30, 2006 1:42 am

Sounds interesting, and theoretically it would work, but natural selection doesn't work that way.
Generally speaking, the more people talk about "being saved," the further away they actually are from true salvation.

#2 Total Post Count

User avatar
King Cobra
King Cobra
Posts: 1039
Joined: Tue Jan 24, 2006 8:51 pm
Location: Oregon, USA

Post by AstusAleator » Sun Apr 30, 2006 2:08 am

I believe you would eventually get to a point where selecting purely according to genetic sequences would result in a sterile or completely deleterious line. It would dead-end.
Even if you were to "help" the evolution by inserting human gene sequences into the genome of the creature, it would be pure alchemy. Essentially throwing a bunch of ideas and reagents together and seeing what happens.

Posts: 4
Joined: Sat Apr 29, 2006 6:41 am

Post by marsh8472 » Sun Apr 30, 2006 2:35 am

AstusAleator wrote:I believe you would eventually get to a point where selecting purely according to genetic sequences would result in a sterile or completely deleterious line. It would dead-end.
Even if you were to "help" the evolution by inserting human gene sequences into the genome of the creature, it would be pure alchemy. Essentially throwing a bunch of ideas and reagents together and seeing what happens.

Yeah this issue was raised already. Whether or not a point would come where they had so many flaws in their DNA that they were genetically doomed. Luckily since the experiment is being run on an infinite number of populations at once, all possible evolutionary routes that can happen will happen. So in one of those populations among infinite populations, there would be just the right order of flawless mutations to ensure a safe evolution to human. Nature is pretty resilient though, I doubted this would be necessary. The only thing really to worry about is whether there's a causal chain of mutations that can alter cockroaches in such a way that evolve them to humans. I see no reason why not.

User avatar
David George
Posts: 317
Joined: Tue Feb 21, 2006 12:48 pm
Location: India [place where religion rules people]

Post by David George » Sun Apr 30, 2006 6:08 am

I think a cockroaches have not evolved for many years as the have evolved chitin and also many other organs they could survive much better than humans without technology.Also they are insects and down the group and it takes much more time for it to evolve to a mammal also they must follow the same track that humans evolved that is pretty much impossible naturally so it is very hard to see a species evolve to humans 100 %
"Nothing in biology makes sense except in the light of evolution"
-Theodosius Dobzhansky

Posts: 4
Joined: Sat Apr 29, 2006 6:41 am

Post by marsh8472 » Sun Apr 30, 2006 6:11 am

These things have already been talked about ... art-0.html

User avatar
King Cobra
King Cobra
Posts: 1039
Joined: Tue Jan 24, 2006 8:51 pm
Location: Oregon, USA

Post by AstusAleator » Tue May 02, 2006 2:32 am

That's interesting.
In your first proposal, it sounded like you would be monitoring the genetic sequences of the cockroaches, comparing them to human dna, and keeping the most similar ones alive. That method alone, even in an infinite number of populations, could not work. The same exact gene sequence in the same exact location on an organisms genome can code for different things, as it depends on the RNA to interpret and translate it. So if your human genome is AATGCCTCCGAAGATACATAGG
and your cockroach is AATGTATGATATGGCCGCGTCGATC then according to your original assumption you would keep a mutant with the genes AATGCCTAAGACTACCTAACTA alive because it has more nucleic acids in common with the human genome. First of all there's a large chance that this mutant would be dead, but in your parallel universe it's alive... so what has the mutation done? Probably something drastically different that what it expresses in humans.

Anyhow, I don't think that your model would work based entirely on selecting for similar gene sequences with humans. However, I think it might be possible, following what we know about evolution.
If you could devolve (yes I know we've discussed this, there's no such thing as backwards evolution) your cockroaches to express more ancestral traits. The problem with trying to backtrack evolution is that many mutations are irreversible. It would also be incredibly hard (impossible) to know which traits to "devolve" and in what order.
Anyway, if you could devolve your cockroach back to an acoelomate and then begin forward evolution towards vertebrae... maybe. Of course this is all just in your little fantasy world, and thus impossible.
But theoretically... maybe... most likely not, but mayyyybbbbeeeee....

If you had chosen something like a frog or lizard that might be a little more doable.
What did the parasitic Candiru fish say when it finally found a host? - - "Urethra!!"

Post Reply

Who is online

Users browsing this forum: No registered users and 13 guests