DNA to mRNA

Discussion of all aspects of biological molecules, biochemical processes and laboratory procedures in the field.

Moderators: honeev, Leonid, amiradm, BioTeam

Post Reply
HALLSTUDENT
Garter
Garter
Posts: 1
Joined: Sun Mar 26, 2006 6:17 pm

DNA to mRNA

Post by HALLSTUDENT » Sun Mar 26, 2006 6:22 pm

Hey out there!
I have a biology questions that is totally blowing my mind.
I am take to following DNA template stand and give the corresponding mRNA as well as the corresponding amino acid sequence. I understand that in RNA you have a U not a T but when does it change over? How do I find the amino acid sequence? I am so lost!

Here is the template
CTGATACGTTGTAGGCGACCTCGTCCCCTGAAATTGCC

Can any one help?
Thanks

User avatar
MrMistery
Inland Taipan
Inland Taipan
Posts: 6832
Joined: Thu Mar 03, 2005 10:18 pm
Location: Romania(small and unimportant country)
Contact:

Post by MrMistery » Sun Mar 26, 2006 7:38 pm

This is a classic molecular genetics exercise.
First you gotta know how the nitrogen bases bind in mRNA formation. Since you are only given one strand of DNA and no 3' 5' ends i assume you are supposed to take it from left to right.
Now, the binding. mRNA is formed by binding of nitrogen bases to the original DNA strand, and then releasing. SO you basically replace:
A with U
T with A
G with C
C with G

Uracil occurs in mRNA instead of thymine.
For the aminoacids, it's easy. Look them up in the genetic code. here is a copy: http://www.mun.ca/biology/scarr/MGA2-03-28.jpg
Each triplet of 3 nucleotides will result in one aminoacid in your protein. A funny thing, they gave you 38 nucleotides, so you will have 2 spare nucleotides. And another strange thing, your protein doesn't start with metionin as it should and you have a stop codon in the middle of your protein...
"As a biologist, I firmly believe that when you're dead, you're dead. Except for what you live behind in history. That's the only afterlife" - J. Craig Venter

Post Reply

Who is online

Users browsing this forum: No registered users and 6 guests