Visualization of DNA, nucleotide sequence

Discussion of all aspects of biological molecules, biochemical processes and laboratory procedures in the field.

Moderators: honeev, Leonid, amiradm, BioTeam

Post Reply
SystemRGB
Garter
Garter
Posts: 12
Joined: Fri Nov 14, 2014 11:33 pm

Visualization of DNA, nucleotide sequence

Post by SystemRGB » Fri Aug 28, 2015 4:53 pm

Image

TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAG TTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGA TATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT

CCGGTATGAATTCTCCGCGCAATAAGCCATCTCCCTACCGCATTGCATCAAAGCATTTCACAGCAGTCCAGCCC CGAGGTTCAGGGTCTCGGAGCTTCTGTCGACAGTAACAACCGGGTCGTGCCCGCCATCAATCGGTATCTTAAAT AAATAGAAATCTTTAGAGGCCGGTGGTAATACAGTTAGATCGACATAGTAAATAGGCTCAGAACTA

CTACGTATAAGGCGCTCTGATTGACGAAATGAGAACTAGAGCAGTACCGGGGAGGTCTTGTTAACTACGTTATA GGGAGCGCCCCTGCATTAACCCCCCCTGCGAGCTGTCATAGAAGCCCAATACGTGGACGTACCAATGAAGAGTA ACGACTCTAGTAGCGTCATGTACCACATACCCGTACTCAGACACACACGGGTACGCGATTGAGCACG

see site presenting Visualization of nucleotide sequence invented in 2015 by Polish scientist Gregory Podgorniak:
http://studia.scienceontheweb.net/visualization.php

Post Reply

Who is online

Users browsing this forum: No registered users and 3 guests