Visualization of sequences of nucleotides, sequence of DNA

Genetics as it applies to evolution, molecular biology, and medical aspects.

Moderators: honeev, Leonid, amiradm, BioTeam

Post Reply
SystemRGB
Garter
Garter
Posts: 12
Joined: Fri Nov 14, 2014 11:33 pm

Visualization of sequences of nucleotides, sequence of DNA

Post by SystemRGB » Sun Aug 02, 2015 9:17 pm

Sequence of 215 nucleotides x 3

Image

TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAG TTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGA TATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT

CCGGTATGAATTCTCCGCGCAATAAGCCATCTCCCTACCGCATTGCATCAAAGCATTTCACAGCAGTCCAGCCC CGAGGTTCAGGGTCTCGGAGCTTCTGTCGACAGTAACAACCGGGTCGTGCCCGCCATCAATCGGTATCTTAAAT AAATAGAAATCTTTAGAGGCCGGTGGTAATACAGTTAGATCGACATAGTAAATAGGCTCAGAACTA

CTACGTATAAGGCGCTCTGATTGACGAAATGAGAACTAGAGCAGTACCGGGGAGGTCTTGTTAACTACGTTATA GGGAGCGCCCCTGCATTAACCCCCCCTGCGAGCTGTCATAGAAGCCCAATACGTGGACGTACCAATGAAGAGTA ACGACTCTAGTAGCGTCATGTACCACATACCCGTACTCAGACACACACGGGTACGCGATTGAGCACG

more informations you can find here:
http://studia.scienceontheweb.net/visualization.php

SystemRGB
Garter
Garter
Posts: 12
Joined: Fri Nov 14, 2014 11:33 pm

Re: Visualization of sequences of nucleotides, sequence of D

Post by SystemRGB » Sun Aug 02, 2015 10:31 pm

Sequence of 744 nucleotides

Image

GCGGCTTCCTACCTTTAGCTCCGAGTATAGTGAGGCCTAGATATGCGCGGGCAGGTAGCTACAGTGTATACATG CTCGTTCTGCGGCATGCGGATATAAATTAAGGATAATACTCAAGTGTTCCAGGGGAGCAGTCATAAAGCACAAC TTCATTATCCCTAAGCTCAGTTAATCTAAGCATGTTTAGCGCTAAGTCTCGTCTACGCGGCAAATACTTTGTAA GCGTTTCTTTAACTTGCCGCTCTCAGAAGGGGCACGGCCGTCATTATGTAACAAGAACGAGTCTCTTACTGGTT GTGCGAGTGGAATGGAGCAACGATGTACGTGTACCGGAAATTTCTAAGGTTTCCCGGCGTATCGATCAAGTCCA GGTTACCGCCTCCCGACAAGGGTATGCTCAACATCCACTGCTGCTGTCCTACGCTCCCTTGGAGACCAATCCTG CGTCATTCAAACTTCGAACATGCGCCGGCATTGTATGTTCATGCCGATAGTGGGTTCATGTTGTGTTATTTACA TTCACTGAGTGGCTTCTGCATGTTTCTGGCTCGCCCGAGACTGATCACGCAAAAAATCTCAGAGATGAACTCAA CTGTACCCGTATAATTGGACCAAAGCTGTCGCGCAGCCGTTACGTGCGTATAGTAAATCCAATTTGCTGCAAAT TCAACAAAAAAGACAGGCTCACGATGCGACGATATTTTGATAATTTTCTAGCGGGCTCGGCCAGCGTACAGTGA GAGTTTACTGGTGGCGGCGCTGCTAACACGAGTT

SystemRGB
Garter
Garter
Posts: 12
Joined: Fri Nov 14, 2014 11:33 pm

Re: Visualization of sequences of nucleotides, sequence of D

Post by SystemRGB » Wed Aug 05, 2015 1:37 pm

Image

SystemRGB
Garter
Garter
Posts: 12
Joined: Fri Nov 14, 2014 11:33 pm

Re: Visualization of sequences of nucleotides, sequence of D

Post by SystemRGB » Tue Aug 18, 2015 1:34 pm

the author of visualization and application: Gregory Podgorniak, Poland (2015)

Post Reply

Who is online

Users browsing this forum: No registered users and 3 guests