How to read this tricky electropherogram?

Discussion of all aspects of biological molecules, biochemical processes and laboratory procedures in the field.

Moderators: Leonid, amiradm, BioTeam

Post Reply
kabtq9s
Garter
Garter
Posts: 1
Joined: Sat Feb 21, 2015 2:42 am

How to read this tricky electropherogram?

Post by kabtq9s » Sat Feb 21, 2015 3:23 am

I am doing an exercise to find the sequence of this electropherogram and confirming the results in NCBI Blast site. I wrote the sequence on the graph to the best of my ability of ~100 bp segments and searched them in Blast... nothing came up. All what I know is that this is a human gene. Any ideas?

Here are the three sequences and the actual graph

lane (1)
AAAGTGCATCTCCTCCGACATTGGAGGATCCCAAGCTCTCATGTTGCCCTTATTGTCACCAGTGACATTTATTCCAAACAGGAGTCCTTCGGGCCAGCAAA

lane (2)
GCTGCCCAGGCTTAGCTGCGAGCCCGTCATGGAGAAAAAGCTCAGAGAAAAGCAGTCTGTTGGAGAATGGGACAGTCACCAGAGACACCTCGTGGGGCTCAGCGGTTCT

lane (3)
GAACAGTACCCCGACTGGCCAGCCGAGACATGTTGACCATCCCACCCCATGCGAGCTCATCAAGGAAAGACTAAGTCAGAGAGTCCTCTCTGAC

Image link
https://mysowar.files.wordpress.com/2015/02/img.jpg

User avatar
jonmoulton
Viper
Viper
Posts: 442
Joined: Fri Feb 15, 2008 5:38 pm
Location: Philomath, Oregon, USA

Re: How to read this tricky electropherogram?

Post by jonmoulton » Mon Feb 23, 2015 3:50 pm

Do you know if this is genomic DNA or cDNA? If not, you should BLAST against both the RNA sequences and the genomic DNA sequence.

Post Reply

Who is online

Users browsing this forum: Google Adsense [Bot] and 3 guests