Annealing Temparature

Discussion of all aspects of biological molecules, biochemical processes and laboratory procedures in the field.

Moderators: honeev, Leonid, amiradm, BioTeam

Post Reply
Helics
Garter
Garter
Posts: 42
Joined: Fri Oct 12, 2012 9:10 am

Annealing Temparature

Post by Helics » Tue Feb 18, 2014 10:49 am

My Gene of Interest is 2kb long
Primer-F : GCTCTAGAGTGATAGTAGGCATGG
Primer-R : GCGATATCCTACACCCAAGCTGC


I used the following program:

94C 1min
94C 2min
56C 1min
72C 2min

final elongation 72C 7min

I'm failed to amplify my gene of interest. please help me. :( :( :( :( :(

User avatar
JackBean
Inland Taipan
Inland Taipan
Posts: 5694
Joined: Mon Sep 14, 2009 7:12 pm

Post by JackBean » Tue Feb 18, 2014 12:40 pm

First, you seem to have big difference in the Tms, second the Tms seem to be quite high (62 - 69°C).

Are you sure your denaturation in the beginning is only 1 min or is it a typo? Why do you have such long denaturation during cycling? Why do you have such long annealing? What polymerase do you use? What is the GC content of your GOI? How many cycles did you have? What is the template? What concentration did you use?
http://www.biolib.cz/en/main/

Cis or trans? That's what matters.

Cat
King Cobra
King Cobra
Posts: 635
Joined: Thu Feb 14, 2008 7:40 pm

Post by Cat » Fri Feb 21, 2014 1:14 am

According to NCBI this pair should not amplify anything anyway...

Helics
Garter
Garter
Posts: 42
Joined: Fri Oct 12, 2012 9:10 am

Re: Annealing Temparature

Post by Helics » Sun Feb 23, 2014 4:59 pm

Primer_F: 5'-GCTCTAGAGTGATAGTGAGCATGG-3'

Primer_R: 5'-GCGATATCCTACACCCAAGCTGC-3'


CORRECTED PRIMER SEQUENCE.

THANKS ALL.
I WILL TRY SUGGESTED EXP. CONDITION.

THANKS "vladCH".

Post Reply

Who is online

Users browsing this forum: No registered users and 3 guests