DNA Sequence

Discussion of all aspects of cellular structure, physiology and communication.

Moderators: honeev, Leonid, amiradm, BioTeam

Post Reply
stylishgurl2001
Garter
Garter
Posts: 1
Joined: Sat Oct 15, 2005 9:06 pm

DNA Sequence

Post by stylishgurl2001 » Sat Oct 15, 2005 9:14 pm

Okay I am not very good at biology at all and can't figure out this question. I have been searching for an answer for hours on how to do this.

We are given a mRNA sequence 5' GAUGGAGUCUAAGCGGAUGGA3' and our asked 2 questions.

1. What is the informational DNA sequence that encodes for the word for this portein? Be sure to note the 5' & 3' ends.

2. What is the antisense DAN sequence that would be found in the template starnd for the information sequence that you submitted as an answer for the previous question? Be sure to note the 5' & 3' ends.

Can somebody PLEASE help me with this??

sdekivit
King Cobra
King Cobra
Posts: 586
Joined: Sat Jul 30, 2005 7:16 pm
Location: holland
Contact:

Re: DNA Sequence

Post by sdekivit » Sun Oct 16, 2005 11:11 am

stylishgurl2001 wrote:Okay I am not very good at biology at all and can't figure out this question. I have been searching for an answer for hours on how to do this.

We are given a mRNA sequence 5' GAUGGAGUCUAAGCGGAUGGA3' and our asked 2 questions.

1. What is the informational DNA sequence that encodes for the word for this portein? Be sure to note the 5' & 3' ends.

2. What is the antisense DAN sequence that would be found in the template starnd for the information sequence that you submitted as an answer for the previous question? Be sure to note the 5' & 3' ends.

Can somebody PLEASE help me with this??


1) is easy, since the coding strand has the same code as mRNA only uracil is thymidine in DNA.

2) use complementary basepairing. Remember 3' and 5' are antiparallel, thus you should begin at the right of your given code.

Post Reply

Who is online

Users browsing this forum: No registered users and 1 guest