promoter mutations effects

Discussion of all aspects of biological molecules, biochemical processes and laboratory procedures in the field.

Moderators: honeev, Leonid, amiradm, BioTeam

Post Reply
aves
Garter
Garter
Posts: 2
Joined: Sun Nov 20, 2011 5:34 pm

promoter mutations effects

Post by aves » Sun Nov 20, 2011 5:52 pm

There is dna sequence, I find promoter regions on this sequence and question that: (- 35 REGİON: TTGACA, -10 REGİON: TCCAAT)
Please answer mutation questions on Pribnow sequences
1-change last T residue of pribnow sequence to A,
2-change first A residue of pribnow sequence to T residue,
Please answer mutation question on -35 sequences
1-change second T residue of -35 sequences to A residue,
2-change C residue of -35 region to A residue
What are the affects of these mutations on transcription?
sequence:
5’cttgccatgctaaaggacgtcacattTTGACAgcacaatcttaataaggtttgacatTCCAATcagccccaccttgacacgctctggcccccttgccatgctaaaggacgtcacattttgacagcacaatcttaataaggtttgcttgccatgctaaaggacgtcacattttgacagcacaatcttaataaggtttgttgacactttatgcttccggctcgtataataccctcaccctccaacatgaggatttgcgcatgaccacaatggcggccgccaccctgctgcgcgcgacgccccacttcagcggtctcgc
cgccggccggaccttcctgctgcagggtctgttgtgaccacaatagtaacatccctagacgtaagcggcttttttgcagggtttttgggccctaaaggctccttttggagcctttttttgagcagggtttttgggcccgggctaaaggacgtcacattttgatttttgggcccgggctaaag-3

daniel.kurz
Coral
Coral
Posts: 167
Joined: Fri May 19, 2006 1:47 am

Post by daniel.kurz » Mon Nov 21, 2011 2:27 am

Read your textbook? This sounds like homework that you were assigned for a molecular genetics course.

aves
Garter
Garter
Posts: 2
Joined: Sun Nov 20, 2011 5:34 pm

Post by aves » Mon Nov 21, 2011 7:43 am

yes this is my homework, but the problem is that; there is no textbook! can you help?

Post Reply

Who is online

Users browsing this forum: No registered users and 1 guest