nucleotides

Genetics as it applies to evolution, molecular biology, and medical aspects.

Moderators: honeev, Leonid, amiradm, BioTeam

Post Reply
bearcub
Garter
Garter
Posts: 3
Joined: Tue Apr 14, 2009 6:05 pm

nucleotides

Post by bearcub » Tue Apr 14, 2009 11:11 pm

I have no idea with this question.

A piece of mRNA is 660 nucleotides long but the DNA coding strand from which it was is transcribed was 870 nucleotides long.
i) Explain the difference in the number of nucleotides.
ii) What is the maximum number of amino acids in the protein translated from this piece of mRNA? Explain your answer please.

thanks.

menu
Garter
Garter
Posts: 4
Joined: Wed Apr 15, 2009 5:30 am
Location: Perth, Western Australia

Re: nucleotides

Post by menu » Wed Apr 15, 2009 6:06 am

The coding strand of the DNA is made up of introns (non-coding parts) and exons (coding parts). when the mRNA is transcripted from the DNA it includes all the corresponding parts (both the introns and exons) but then the mRNA is spliced, which is where the introns are taken out. because some are taken out it will be shorter.
For example:
(the bold and underlined letters are the exons)

Coding DNA: TACCGAATAAACGCCGGCCATC
non-spliced mRNA: AUGGCUUAUUUGCGGCCGGUAG
spliced mRNA: AUGGCUUUGCGGUAG

as you can see all the introns (non-bold and non-underlined) parts have been taken out.

The DNA sequence you are looking at has 870 nucleotides and the mRNA only has 660. therefore there must be 210 intron nucleotides which have been spliced.
As for the second part of the question:
3 nucleotides (called a codon) code for an amino acid. and proteins are made up of amino acids.
therefore there must be a maximum of 220 amino acids ( 660 divided by 3)

hope this helped.
dont hesitate to ask if you need more explaining

Post Reply

Who is online

Users browsing this forum: No registered users and 6 guests