Help with Punnet squares and DNA Replication

Human Anatomy, Physiology, and Medicine. Anything human!

Moderators: honeev, Leonid, amiradm, BioTeam

Post Reply
element682
Garter
Garter
Posts: 1
Joined: Fri Mar 24, 2017 10:39 pm

Help with Punnet squares and DNA Replication

Post by element682 » Fri Mar 24, 2017 10:46 pm

In southwest Rhode Island, there is a creature know as a tomcat. It comes in three colors, blue, red, and purple. This trait expresses incomplete dominance. A homozygous dominant individual is blue, a homozygous recessive individual is red, and a heterozygous individual is purple.
a. What would be the genotypes and phenotypes of the offspring if a blue tomcat were crossed with a red one?
d. Why is this considered incomplete dominance and not co-dominance (2pts)
2. A normal female whose father was colorblind marries a normal male whose father was also colorblind. (Color-blindness is a sex-linked recessive gene.)
a. What is the probability that their son will be colorblind?
b. What is the probability that their daughter will be colorblind?
3. Take this strand of DNA:

/6 b.
c. If the F2 generation consisted of only 8 individuals, how many tomcats would be purple?
What are the genotypic ratios of the F2 generation? (1 pts)
* Genotypic ratio is recorded as follows:
(homozygous dominant : heterozygous : homozygous recessive)
/4
/7
AATACCGATACGGGGCAACTAAA
a. Create the complementary DNA Strand (1pt)
b. Create the complementary mRNA strand (from the original)
c. Create the protein (2pts)
d. What happens if AUG appears in the middle of the protein?
e. What are two ways a mutation might affect the protein?
4. Mutations:
a. What type of mutation is this, and how does it affect a protein?
/4
5. A rancher owns a bull (male) with many desirable characteristics. Unfortunately, the bull also has a sex-linked trait in which the recessive form leads to no pigment formation in the iris of the eye. This makes the bull very sensitive to sunlight and could lead to blindness. The rancher wishes to breed him to a cow (female) that will minimize the chances of any offspring showing this trait. Cow 1 is homozygous dominant for the trait, and cow 2 is heterozygous.
Original DNA


Mutated DNA
DNA: TGGTACGGGGCAACTAAA mRNA: ACCAUGCCCCGUUGAUUU
MET-PRO-ARG-STOP
TGGTACGGGGCAACTAAA
This G has been removed from the original DNA strand



b. Is this mutation likely to be good, bad or neutral to the Protein and the overall organism? Why?
/4
a. Which of these two cows should the rancher choose as a mate to her bull if she wishes to minimize the occurrence of the non-pigmented eye in his offspring? (1 pt)
b. What percentage of the male offspring from the cross you selected above will have non-pigmented eyes?
c. Crossing the bull with this cow will NOT eliminate the trait from the herd. Why?

Post Reply

Who is online

Users browsing this forum: No registered users and 10 guests