such as "Introduction", "Conclusion"..etc
This program aims to demonstrate a few salient features of DNA got from a file. We first store the file name in a scalar variable $DNA. We open the file and read the first line of the file and store it $DNA2. As it is scalar it holds only one value at a time and hence the other lines of the file cannot be stored. We again open the same file but this time store the contents of the file in an array so that all the contents can be read and stored as values of the array @DNA.
We do a chomp on the array (@DNA) to remove the “enter” character. The “chop” command is used to remove the last character of a particular value. We demonstrate here the use of chop. When we use chop on the array @DNA (line 16), the last character of each value of the array is deleted or removed.
We use the “join” command to make one complete string of DNA from the array values. In line 22, a complementary of the DNA string ($DNA3) is got by translating A to T, C to G, G to C and T to A and saved again in $DNA3. A point to note here is that the translation works only letter by letter and not with words. We then again translate T to U to get the RNA. We now find the length of RNA by using the command called “length”. We then find out the total number of bases or nucleotides in the string by calculating the number of occurrences occurred while translating each of the nucleotides to a null value (see line 31 to 34) and totaling all the individual values.
We find out the GC percentage by calculating the number of occurrences while substituting the GC with itself, dividing it by total and multiplying it by 100. We substitute it by itself as we do not want to disturb the DNA structure but would want to know how many GCs are present. The number of adenines are already calculated in the line 31 we just do a copy to $A. We then use the substitute command to substitute the AUG and UAG to start and stop respectively.
RESULT:
the sequence of single strand of DNA:
TACTGTGGCCGTGCGTGGCTGCCGTTGCGCTGC
the sequences of multiple strands of DNA:
TCCTCGGGTCGATGCGATAGCTAGCTAGATCTT
the result of chomp:TACTGTGGCCGTGCGTGGCTGCCGTTGCGCTGC TCCTCGGGTCGATGCGATAGCTAGCTAGATCTT
the result of chop unction:TACTGTGGCCGTGCGTGGCTGCCGTTGCGCTG TCCTCGGGTCGATGCGATAGCTAGCTAGATCT
the result of join:
TACTGTGGCCGTGCGTGGCTGCCGTTGCGCTGTCCTCGGGTCGATGCGATAGCTAGCTAGATCT
the result of complementary:
ATGACACCGGCACGCACCGACGGCAACGCGACAGGAGCCCAGCTACGCTATCGATCGATCTAGA
the transcribed RNA:
AUGACACCGGCACGCACCGACGGCAACGCGACAGGAGCCCAGCUACGCUAUCGAUCGAUCUAGA
the length of RNA:64
the total nucleotides:in RNA:64
the total number of GC in DNA :7:
the GC percentage:10.9375
the total number of Adenines:18
the start and stop codon:
startACACCGGCACGCACCGACGGCAACGCGACAGGAGCCCAGCUACGCUAUCGAUCGAUCStopA
the result of chop:
startACACCGGCACGCACCGACGGCAACGCGACAGGAGCCCAGCUACGCUAUCGAUCGAUCStop
Enter the code exactly as it appears. All letters are case insensitive, there is no zero.