Submit a Revision

*your email :**
page name* : such as "Introduction", "Conclusion"..etc
<p style="text-align:justify;"> <span style="font-size:10pt;font-family:Arial;">The objective of the program is <strong>to calculate the</strong> <strong>length of the given DNA sequence</strong> and <strong>to find out the</strong> <strong>total number of dinucleotides’ sequences</strong> viz GCs and ATs in the DNA. </span> </p> <p style="text-align:justify;"> <span style="font-size:10pt;font-family:Arial;"> </span> </p> <p style="text-align:justify;"> <span style="font-size:10pt;font-family:Arial;">At first we assign the value of the DNA to a scalar variable called $DNA. The length of the DNA could be obtained by just using a command called “length”, result of which is stored in $length. <span> </span><span> </span>The number of ‘A’ bases in the DNA are calculated by calculating the number of translations occurred by translating the ‘A’ to NULL in line 6.<span> </span></span><span style="font-size:10pt;font-family:'Courier New';">$DNA=~tr/A// </span><span style="font-size:10pt;font-family:Arial;">translates the ‘A’ to NULL and by putting it in brackets and assigning it to another variable gives the number of occurrences. Similarly we get the number of ‘C’, ‘G’, ‘T’ bases. We then can total all the bases with the use of ‘+’ as in normal arithmetic calculations. It is same with subtraction, multiplication and division. To count the number of GCs in the DNA (line 13) we use substitute the GC with GC itself as we just need the number of occurrences but do not want to distort the DNA. As substitution would change the DNA values but the translation does not, it only translates the value to a new one. We did not use the translation in line 13 as we have more than one letter that is a word. Similarly we would also obtain the number of ATs.</span> </p> <p style="text-align:justify;"> <span style="font-size:10pt;font-family:Arial;"> </span> </p> <p style="text-align:justify;"> <span style="font-size:10pt;font-family:Arial;">The percentage of GCs is got by using the percentage formula. </span> </p> <p> <span style="font-size:10pt;font-family:'Courier New';"> </span> </p> <ol style="margin-top:0in;"><li><span style="font-size:10pt;font-family:'Courier New';">#Calculating the length, total nucleotides, dinucleotide sequence GC and AT counts</span></li> <li><span style="font-size:10pt;font-family:'Courier New';">$DNA="TACCGTGTAAGCTGCGTATGCGATCGTACGCGTGTGCGGT";</span></li> <li><span style="font-size:10pt;font-family:'Courier New';">#length of DNA</span></li> <li><span style="font-size:10pt;font-family:'Courier New';">($length=length$DNA);</span></li> <li><span style="font-size:10pt;font-family:'Courier New';">print"the length of DNA $length\n";</span></li> <li><span style="font-size:10pt;font-family:'Courier New';">$a=($DNA=~tr/A//);</span></li> <li><span style="font-size:10pt;font-family:'Courier New';">$b=($DNA=~tr/C//);</span></li> <li><span style="font-size:10pt;font-family:'Courier New';">$c=($DNA=~tr/G//);</span></li> <li><span style="font-size:10pt;font-family:'Courier New';">$d=($DNA=~tr/T//);</span></li> <li><span style="font-size:10pt;font-family:'Courier New';">$Total=$a+$b+$c+$d;</span></li> <li><span style="font-size:10pt;font-family:'Courier New';">print"total bases in DNA $Total:\n";</span></li> <li><span style="font-size:10pt;font-family:'Courier New';">#count of GC</span></li> <li><span style="font-size:10pt;font-family:'Courier New';">$GC=($DNA=~s/GC/GC/g);</span></li> <li><span style="font-size:10pt;font-family:'Courier New';">print"the total number of dinucleotide GC in DNA :$GC:\n";</span></li> <li><span style="font-size:10pt;font-family:'Courier New';">#count of AT</span></li> <li><span style="font-size:10pt;font-family:'Courier New';">$AT=($DNA=~s/AT/AT/g);</span></li> <li><span style="font-size:10pt;font-family:'Courier New';">print"the total number of dinucleotide AT in DNA:$AT:\n";</span></li> <li><span style="font-size:10pt;font-family:'Courier New';">#percentage of GC</span></li> <li><span style="font-size:10pt;font-family:'Courier New';">$GCper=($GC/($Total)*100);</span></li> <li><span style="font-size:10pt;font-family:'Courier New';">print"the percentage of GC: $GCper:\n";</span></li> <li><span style="font-size:10pt;font-family:'Courier New';">exit;</span></li> </ol><p> <span style="font-size:10pt;font-family:'Courier New';"> </span> </p> <p> <strong><span style="font-size:10pt;font-family:'Courier New';">RESULTS<span>:</span></span></strong> </p> <p> <span style="font-size:10pt;font-family:'Courier New';"> </span> </p> <p> <span style="font-size:10pt;font-family:'Courier New';">the length of DNA 40</span> </p> <p> <span style="font-size:10pt;font-family:'Courier New';">total bases in DNA 40:</span> </p> <p> <span style="font-size:10pt;font-family:'Courier New';">the total number of dinucleotide GC in DNA :5:</span> </p> <p> <span style="font-size:10pt;font-family:'Courier New';">the total number of dinucleotide AT in DNA:2:</span> </p> <p> <span style="font-size:10pt;font-family:'Courier New';">the percentage of GC:12.5:</span> </p>
Confirmation code: Enter the code exactly as it appears. All letters are case insensitive, there is no zero.