such as "Introduction", "Conclusion"..etc
Our approach was to develop a microbial system that reports sugar levels in a reaction that mimics the NREL lignocellulosic ethanol production process [4]. The presence of microbes in this system overcomes the feedback inhibition problems associated with enzyme-only methods. Escherichia coli strain CA8404 was selected as the microbe because it carries the crp* mutation which reduces catabolite repression and thereby allows both the 5- and 6-carbon sugars produced from corn stover hydrolysis reactions to be metabolized simultaneously [9]. As the E. coli metabolize the sugars from the hydrolysis reaction, cell mass (X) changes at a rate of dX/dt. This change in culture cell mass can be monitored by light-scattering measurements of culture turbidity. However, certain reactions, including lignocellulosic biomass hydrolysis, produce substances that interfere with light-scattering measurements. In order to more easily monitor change in cell culture mass, the E. coli strain CA8404 was modified to produce a visual marker, green fluorescent protein (GFP) [10,11]. The sharp emission peak and specific wavelength requirement for excitation allow for a much greater specificity of detection than does light scattering alone. The version of GFP used in this study (S65T) has a maximum excitation wavelength of 490 nm and a maximum emission wavelength of 510 nm [12].
Site-directed mutagenesis was conducted according to the Stratagene product QuikChange II® Site-Directed Mutagenesis kit in order to produce a pPNptGreen plasmid without a functional GFP fluorophore (Stratagene, La Jolla, CA). Approximately 300 bp into the GFP coding sequence, DNA encoding a glutamate residue (GAA) was changed to encode a stop codon (TAA). (Primers for mutagenesis: Forward: GATGACGGGAACTACAAGACACGTGCTTAAGTCAAGTTTGAAGG; Reverse: CCTTCAAACTTGACTTAAGCACGTGTCTTGTAGTTCCCGTCATC.) The new plasmid was designated pPNptOchre. The original pPNptGreen plasmid and the pPNptOchre plasmid without the functional GFP fluorophore were transformed separately into E. coli strain CA8404 to produce the two strains, crp*-gfp and crp*-gfp-.
At grain maturity, cobs were removed from the corn plants and all corn stover samples were cut at approximately six inches above the soil by a forage chopper. Approximately 0.8 kg of sample (wet weight) at a moisture content of about 35% was collected from each plot and samples were dried at 55°C for one week. The material from each sample was ground by a hammermill with a 1 mm screen. We did not evaluate the distribution of different botanical tissues in the ground material; however, the ground material appeared uniform. To minimize the effect of a non-uniform distribution of biological material in the sample we used multiple subsamples in each experiment.
To characterize the product inhibition of the enzyme preparation Multifect® A-40 (a cellulase/hemicellulase mixture from Genencor Intl.), we carried out hydrolysis reactions in the presence or absence of 10 mM d-glucose (CAS# 50-99-7, Sigma-Aldrich Inc., St. Louis, MO). Each treatment was run with four replicates using 5 mg of a stover sample treated with a 1:20 dilution of enzyme Multifect® A-40 in citrate-phosphate buffer (21 ml 0.1 M citric acid and 29 ml 0.2 M sodium phosphate, in a final volume of 100 ml, pH 5.5). Hydrolysis was conducted at 60°C for 90 min. Following hydrolysis, the tubes were centrifuged for 1.5 min. at 10,000 × g in a microcentrifuge (Spectrafuge, Orem, UT). An aliquot of the supernatant from the hydrolysis reaction was measured with a hexokinase glucose assay kit (Sigma-Aldrich Inc., St. Louis, MO). The absorbance was measured at 340 nm (OD340) using the MRXII plate reader by DYNEX (Magellan Biosciences Company, Chelmsford, MA). The absorbance value was converted to glucose yield with a standard curve constructed by plotting OD340 values versus glucose concentrations following analysis of a series of solutions with known glucose concentrations.
Cultures of E. coli crp*-gfp and crp*-gfp- paired by treatment were grown in modified 1 × M9 minimal media [13]. The M9 media was modified by the addition of Kanamycin (50 μg/ml), thiamine (0.01% w/v), and ammonium chloride (5 mg/ml). Also, different carbon source concentrations were provided to the cultures than the carbon source described by Sambrook and Russell [13]. d-glucose (CAS# 50-99-7, Sigma-Aldrich Inc., St. Louis, MO), and d-xylose (CAS# 58-86-6, Sigma-Aldrich Inc., St. Louis, MO) solutions were made in the appropriate concentrations indicated in each experimental procedure below. All sugar solutions were filter-sterilized and frozen. Sugar mixtures were combined from separate, sterilized glucose and xylose sugar solutions. Cultures were grown in clear, 96-well cell culture plates (Product # 92096, Techno Plastic Products, Trasadingen, Switzerland) and sealed with AirPore™ seals (Qiagen, Valencia, CA) in order to ensure that enough oxygen was available to the cultures. The plates were then securely fastened down in the Innova 4300 incubator shaker (New Brunswick Scientific, Edison, New Jersey), and allowed to incubate with shaking at 37°C and 225 rpm. When it was time to take a measurement, the AirPore™ seal was removed only from the wells to be measured, and absorbance (OD595) measurements were taken by the MRXII plate reader (Dynex – a Magellan Biosciences Company, Chelmsford, MA). The samples from the wells to be measured were then transferred into a black, 96-well cell culture plate (Corning Incorporated Life Sciences, Lowell, MA), and fluorescence measurements (excitation wavelength: 485 nm, emission wavelength: 535 nm) were taken by the SpectraFluor Plus plate reader (Tecan US, Research Triangle Park, NC). Note that these wavelengths (595 nm for absorbance, 485 nm for excitation, and 535 nm for emission) were used consistently throughout the study. The AirPore™ seal was replaced on the clear 96-well plate and returned to the incubator. To obtain a value for GFP-specific fluorescence for each culture pair, the fluorescence reading of the crp*-gfp- strain was subtracted from the fluorescence reading of the crp*-gfp strain.
To establish whether it was possible to use GFP to detect differences in changes in culture cell mass in response to sugars, cultures of E. coli crp*-gfp and crp*-gfp- were grown in modified 1 × M9 minimal media containing 2, 4, or 8 mg/ml d-glucose. Absorbance and fluorescence were measured every 2 h for 22 h, and the GFP-specific fluorescence was determined.
To determine the sensitivity and dynamic range of the microbial system, cultures of E. coli crp*-gfp and crp*-gfp- were grown in modified 1 × M9 minimal media containing d-glucose in concentrations ranging from 0.025 mg/ml to 6.0 mg/ml. Absorbance and fluorescence measurements were taken 20 h after inoculation, and the GFP-specific fluorescence was determined.
To determine the response time of the microbial system, glucose was added to the reaction when the culture reached stationary phase. Two sets of three replications of both E. coli strains crp*-gfp and crp*-gfp- were grown in modified 1 × M9 minimal media containing 2 mg/ml d-glucose for 20 h. After 20 h, half of the cultures (one set) were randomly selected to receive an addition of 8 mg/ml d-glucose for a total of three replications each of spiked cultures and unspiked cultures. Absorbance and fluorescence were measured every 2 h, and the GFP-specific fluorescence was determined.
Another way we examined the response time of the microbial system was by stopping protein production when the culture was in mid-log phase. Six replications of both E. coli strains crp*-gfp and crp*-gfp- were grown in modified 1 × M9 minimal media, containing 20 mg/ml d-glucose. Chloramphenicol was added to a random selection of half of the cultures after 13 h for a total of three replications each of cultures with chloramphenicol and without chloramphenicol. Absorbance and fluorescence were measured every hour, and the GFP-specific fluorescence was determined.
The microbial system described here, referred to as simultaneous saccharification and catabolism (SSC) was used to analyze corn stover samples of five different corn varieties. For each sample to be analyzed, 25.0 ± 0.2 mg of dried and ground corn stover was weighed into two separate 14 ml sterile test tubes (BD Biosciences, San Jose, CA). Two tubes were used to control for variations in fluorescence of the corn stover samples: an experimental tube to be inoculated with crp*-gfp and a control tube to be inoculated with crp*-gfp-. The difference in the fluorescence of these two tubes was used to determine the GFP-specific fluorescence. Then 1150 μl of 0.5% (v/v) sulfuric acid were added to each tube, and the tubes were incubated at 100°C for 1 h [14]. The tubes were allowed to cool for 15 min after incubation, after which 3850 μl of bacterial media inoculum (2 × M9 media inoculated with the appropriate bacterial culture) was added to each tube. 1 l of bacterial media inoculum contained 620 ml sterile water, 330 ml 5 × M9 salts, 6.6 ml 1 M MgSO4, 164.2 μl 1 M CaCl2, 1.7 ml thiamin at 10%, 8.3 ml kanamycin at 10 mg/ml, and 33 ml crp*-gfp or crp*-gfp- liquid culture (grown overnight at 37°C in 1 × M9 media to an OD595 of ~0.6). In addition, 25 μl of 1:1 GC220: Multifect® Xylanase (Genencor Intl.) were added to each tube. The tubes were allowed to incubate with shaking at 37°C and 225 rpm. Samples containing 100 μl of 0, 2, 4, 6, 8, 10, 12, 14, 16, or 18 mg/ml sugar at ratios of 37.5 xylose: 62.5 glucose in place of corn stover were included as positive controls. Absorbance and fluorescence were measured after 20 h of incubation by allowing the stover particles to settle in the culture tube and transferring 100 μl of the culture to a 96-well plate.
The GFP-specific fluorescence values were computed by subtracting the fluorescence from crp*-gfp- cultures from crp*-gfp cultures. These values were then analyzed by ANOVA in order to characterize variation in the experiment. When variation was significant, a student's t-test was performed on each pair to compare means of the samples. The coefficient of variance (CV) was also computed in order to determine the variation in measurements for each genotype.
The SSC method described above was used to analyze stover samples from five corn varieties. Absorbance and fluorescence were measured every 2 h for 24 h and once at 36 h.
Enter the code exactly as it appears. All letters are case insensitive, there is no zero.