Profiling of chicken adipose tissue gene expression by genome array

Abstract

Profiling of chicken adipose tissue gene expression by genome array

Hong-Bao Wang1, Hui Li1, Qi-Gui Wang1, Xin-Yu Zhang2, Shou-Zhi Wang1, Yu-Xiang Wang1 and Xiu-Ping Wang3

1College of Animal Science and Technology, Northeast Agricultural University, Harbin, 150030, P.R. China
2Ministry of Education Key Laboratory of Bioinformatics, School of Biomedicine, Tsinghua University, Beijing, 100084, P.R. China
3Shanghai Biochip Co., Ltd., Shanghai, 201203, P.R. China

Background

Excessive accumulation of lipids in the adipose tissue is a major problem in the present-day broiler industry. However, few studies have analyzed the expression of adipose tissue genes that are involved in pathways and mechanisms leading to adiposity in chickens. Gene expression profiling of chicken adipose tissue could provide key information about the ontogenesis of fatness and clarify the molecular mechanisms underlying obesity. In this study, Chicken Genome Arrays were used to construct an adipose tissue gene expression profile of 7-week-old broilers, and to screen adipose tissue genes that are differentially expressed in lean and fat lines divergently selected over eight generations for high and low abdominal fat weight.

Results

The gene expression profiles detected 13,234–16,858 probe sets in chicken adipose tissue at 7 weeks, and genes involved in lipid metabolism and immunity such as fatty acid binding protein (FABP), thyroid hormone-responsive protein (Spot14), lipoprotein lipase(LPL), insulin-like growth factor binding protein 7(IGFBP7) and major histocompatibility complex (MHC), were highly expressed. In contrast, some genes related to lipogenesis, such as leptin receptor, sterol regulatory element binding proteins1 (SREBP1), apolipoprotein B(ApoB) and insulin-like growth factor 2(IGF2), were not detected. Moreover, 230 genes that were differentially expressed between the two lines were screened out; these were mainly involved in lipid metabolism, signal transduction, energy metabolism, tumorigenesis and immunity. Subsequently, real-time RT-PCR was performed to validate fifteen differentially expressed genes screened out by the microarray approach and high consistency was observed between the two methods.

Conclusion

Our results establish the groundwork for further studies of the basic genetic control of growth and development of chicken adipose tissue, and will be beneficial in clarifying the molecular mechanism of obesity in chickens.


BMC Genomics 2007, 8:193. This is an Open Access article distributed under the terms of the Creative Commons Attribution License.


Background

The chicken is an important model organism that bridges the evolutionary gap between mammals and other vertebrates [1]. Research on chickens (Gallus gallus) has had a significant impact on fundamental biology. The domestic chicken also provides a major protein source from meat and eggs for most human populations throughout the world. Its economic importance has made it the focus of numerous research projects, including a recent effort to sequence the entire chicken genome [2].

During the past 80 years, selective breeding has made spectacular progress in both egg and meat production traits. The modern commercial broiler is the product of intensive selection for rapid growth and enhanced muscle mass over many generations. Associated with these successes there have been a number of undesirable traits, such as ascites and lameness, reduced fertility, and reduced resistance to infectious diseases [3]. Selection for rapid growth has been also accompanied by increased fat deposition in these animals [4,5]. Excessive fat is a major problem for the modern broiler industry, since it not only reduces carcass yield and feed efficiency, but also causes rejection of the meat by consumers [6] and difficulties in processing [7].

With the rapid development of molecular biotechnology, various studies have been performed to investigate the metabolic and genetic mechanisms involved in the regulation of fatness in chickens. Because de novo fatty acid synthesis in birds takes place mainly in the liver, most studies have been performed on hepatic tissue. There have been few analyses of the expression of adipose tissue genes involved in pathways and mechanisms leading to adiposity in chickens. In the present study, Chicken Genome Arrays were used to construct the gene expression profiles of 7-week-old broilers, and to screen genes that are differentially expressed in adipose tissue between lean and fat lines divergently selected over eight generations for high and low abdominal fat weight. Our study will be beneficial in clarifying the molecular mechanisms of obesity in chicken, and these data will contribute to related research on other species.

 


Results

Characterization of the two chicken lines

It is clear that the percentages of abdominal fat in the two lines have become very different after selecting for eight generations (Figure 1). In the eighth generation, the AFP is 2.95% in the fat chicken line and 1.55% in the lean line.

The chickens used in this study differed significantly not in body weight but in abdominal fat weight and percentage of abdominal fat (Figure 2) and were chosen on that basis. AFP in the fat line was three times that in lean line (Table 1).

Adipose tissue gene expression profile

The pattern of adipose tissue gene expression of chickens at 7 weeks was analyzed by oligonucleotide microarrays. Normalized data were used to analyze the total expressed genes. Depending on the individual bird, 13,234–16,858 probe sets were detected (bird 7-3-16 was excluded from subsequent analysis for the reason given below). Subsequently, the distribution of expression levels of genes in adipose tissue was calculated by JMP4.0 (Figure 3). The genes were ordered according to their mean expression levels; those with expression levels in the highest or lowest 1% were considered highly expressed or the converse. Some of the genes with especially high or low expression levels are named in Tables 2 and 3.

We also believe that genes described as "not expressed" can provide useful information about the function of adipose tissue and lipid metabolism in chicken. Table 4 shows some of these genes, selected using the software Affymetrix Microarray Suite 4.0. Many genes allegedly involved in lipid metabolism and obesity were not expressed in adipose tissue in the 7-week-old chickens.

Analysis of consistency within the fat and lean lines

Although there is little difference among individuals in the AFW and AFP within each line, individuals in each line may differ in hereditary molecular characters. By comparing the consistency within each line, the selective effect can be evaluated properly, and chickens that deviate too much from the norm can be excluded from subsequent screening of differentially expressed genes. This makes the analysis of differentially expressed genes more reliable and credible. The cluster analysis results showed that the fat line individuals, except chicken 7-3-16, were more consistent that the lean line ones. Chicken 7-3-16 deviated too much from the other fat line chickens (R4.

Identification of differentially expressed genes

In order to identify the differentially expressed genes, Significance Analysis of Microarrays (SAM) was performed on normalized data as described by Tusher et al. [8]. To avoid the low-variance problem in t-tests, SAM uses a statistical method similar to the t-test and estimates the false discovery rate by permutation of repeated measurements [8]. Subsequently, a two-class SAM analysis was performed on the log transformed data matrix (see Materials and Methods). A cutoff value, delta, depending on an arbitrary false positive rate, was chosen to identify genes that were significantly differentially expressed. For this analysis, a delta value of 0.8 was used (Figure 5). This led to the identification of a total of 230 differentially expressed genes: 153 were up-regulated and 77 were down-regulated in fat chickens compared to lean chickens (Figure 6). Highly differentially expressed genes were further selected by the fold change (fat/lean). These differentially expressed genes were mainly involved in lipid metabolism, energy metabolism, signal transduction, immunity and tumorigenesis. Table 5 is a summary of the most representative of these genes.

Validation of gene expression data by quantitative real-time PCR

To validate the microarray results, we performed quantitative real-time PCR for: propionyl-coenzyme A-carboxylase (PCC), similar to 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase gamma 2 (PBP2), tumor necrosis factor, alpha-induced protein 1 (TNFAIP1), fms-related tyrosine kinase 1 (FLT1), glycerol-3-phosphate dehydrogenase 2 (G3PD), low density lipoprotein-related protein 12 (LRP12), prostaglandin E receptor 3 (PER), suppression of tumorigenicity 7 (ST7), similar to endoplasmic reticulum oxidoreductin 1-Lbeta (ERO1), ataxin 3 (ATXN3), parvin, alpha (PARVA), CWF19-like 2 (CWF19), similar to Stxbp4 protein (Stxbp4), acyl-CoA oxidase (ACO), and suppressor of cytokine signaling 7(SOCS7) (Table 6). In all but one case (TNFAIP1), the real-time RT-PCR fold differences were in complete correspondence with the microarray data. Table 7 compares the microarray and real-time RT-PCR results.


Discussion

Because de novo fatty acid synthesis in birds takes place mainly in the liver, most studies have been performed on hepatic tissues. The expression of some genes involved in lipid synthesis and secretion has been analyzed in the liver of lean and fat chickens. Bourneuf et al. [9] used a cDNA microarray to analyze the expression of genes in liver that are involved in pathways and mechanisms leading to adiposity, and found some genes differentially expressed between lean and fat chickens. Their research indicated that the mechanisms involved in the expression and regulation of lipogenic genes could play a key role in the ontogenesis of fatness in chickens from lean and fat lines. However, few studies have analyzed the functions of adipose tissue leading to adiposity in chickens.

Genome expression analysis aims to provide a broad and unbiased survey of the transcriptome, and requires true global coverage of a complex genome in a single microarray [10]. Significant progress has been made towards this goal and GeneChip microarrays have been improved significantly since they were invented [11].

The Chicken Genome Array, created by Affymetrix Inc. at the end of 2004 as part of the Ensembl annotation attempt at the complete chicken genome sequence (version 1, released May 2004), is a key research tool in chicken genomics. Our study provides, apparently for the first time, a comprehensive analysis of the chicken adipose tissue gene expression profile using this array. The gene expression profile results showed that 13,234–16,858 probe sets were detected in adipose tissue in 7-week-old chickens. Further study revealed that genes directly involved in lipid metabolism, including Spot14, LPL, adrenomedullin, pyruvate dehydrogenase kinase, isoenzyme 4 and the FABP family: FABP 3 (muscle and heart), FABP 4 (adipocyte) and FABP 5 (psoriasis-associated), were highly expressed in adipose tissue; FABP 4 is the most highly expressed gene in this tissue. These genes are mainly involved in fatty acid transport and degradation. Other genes that are closely related to lipid metabolism and obesity by signal transduction or regulation of transcription were also highly expressed: prosaposin (PSAP), retinol binding protein 7 (RBP7), retinoic acid receptor responder, IGFBP 7, thymosin beta 4, BMP7, superoxide dismutase 2 and annexin A5. In addition, many genes involved in the immune response and cytophylaxis, such as CD74 antigen, MHC class I glycoprotein, MHC class II beta 1 domain, MHC class II antigen alpha, lymphocyte antigen 6, beta-2 microglobulin, T-cell leukemia, Hsp70 and Hsp25, were also highly expressed in adipose tissue. The most highly expressed genes (A-FABP, LPL) were apparently not differentially expressed between fat and lean lines. This may not preclude a major involvement of these factors in regulating lipid metabolism in chick adipose tissue, and further work on protein expression is needed to understand the metabolism of this tissue better. Our results demonstrated primarily that the functions of adipose tissue in chicken are important in lipid metabolism by directly or indirectly regulating the synthesis, transport and degradation of lipids. Moreover, adipose tissue may play an important role in chicken immunity and cytophylaxis. These results will be help to clarify the adipose tissue gene expression profile and to choose appropriate methods for further study of these genes.

On the other hand, genes described as "not expressed", including obr,SREBP1, apoB,CCK,CCKR,IGF2 and lipoprotein (APOVLDLII), which have been studied extensively in other species (mainly Homo sapiens and Mus) and shown to affect obesity, were not detected in chicken adipose tissue in the present study. Possible reasons may be: (1) these genes are not expressed in chicken adipose tissue at all, or not at 7 weeks; (2) lipid metabolism in chicken is different from that in mammals. In birds, lipogenesis mainly occurs in the liver and is very limited in adipose tissue [12]. Although those genes were not detected in adipose tissue, they may regulate lipid metabolism indirectly. Another possible reason is gene interactions: the highly expressed genes may inhibit those with low expression levels and the "not expressed" ones when they participate the same biological responses.

Genetic variation in fatness was analyzed using two experimental lines (fat (FL) and lean (LL)) that were divergently selected for abdominal fat weight from a common genetic background. After selection for eight generations, the AFW and AFP differed significantly between the two lines (Figure 2). By consistency analysis within each line using hierarchical clustering of the total expressed genes, heterogeneity among individuals in each line was demonstrated (Figure 4). The hierarchical clustering results were barely satisfactory: the fat line showed higher consistency (about 87%) than the lean (about 77%). The consistency of each line is not sufficiently maintained. There may be two reasons for this. First, an insufficient number of generations have been used for selection, so the purity of each line will increase as selection continues. Second, our target trait is abdominal fat; after selection for eight generations the genes affecting abdominal fat may be better selected, but the genome array detects all genes expressed in adipose tissue, so genes affecting other traits, which have not been divergently selected, will reveal inter-individual differences within each chicken line. The higher consistency of the fat chicken line (about 87% compared to 77% for the lean line) shows that the fat line is purer than the lean line after being selected for eight generations. In addition, to make our study more reliable, the 7-3-16 individual was excluded from subsequent screening of differentially expressed genes because it deviated too much from the others.

Significance Analysis of Microarrays (SAM) has been considered a canonical algorithm for identifying differentially expressed genes in microarray data analysis. A total of 230 differentially expressed genes were screened by SAM. Fifteen genes that were differentially expressed between the two chicken lines were validated by real-time RT-PCR. To validate the results further, in addition to the samples used in the array experiments, four RNA pools (two from the fat line and two from the lean) were used for real-time RT-PCR analysis to reveal the differentially expressed genes more exactly. The results of this validation were encouraging: in all but one case (TNFAIP1), the real-time RT-PCR fold differences correlated well with the microarray data. Rajeevan et al. [13] evaluated the efficiency of real-time RT-PCR for validating the differentially expressed genes identified by microarrays. Their results indicated that genes showing less than a 2-fold difference in expression were not likely to be validated by real-time RT-PCR. Bourneuf et al. [9] considered that confirmation of genes with fold changes TNFAIP1 in the microarray was -1.6, which is difficult to confirm by real-time RT-PCR, so it is not correct to affirm that the two methods gave contradictory results for this gene.

Our analysis results revealed that the expression levels of some important genes implicated in lipid metabolism were up-regulated in fat chickens: propionyl-coenzyme A-carboxylase, acyl-CoA oxidase, pyruvate dehydrogenase complex, glycerol-3-phosphate dehydrogenase, phosphatidylinositol, lysophospholipase 3, low density lipoprotein-related protein 12, etc. Pyruvate dehydrogenase catalyzes oxidative decarboxylation of pyruvate to form acetyl-CoA, which is a central metabolite [14-16]. Acetyl-CoA enters the Krebs cycle, and is the donor of acetate for synthesis of fatty acids, ketone bodies and cholesterol. The expression level of glycerol-3-phosphate dehydrogenase increased in diet-induced obese animals [17]. Propionyl-coenzyme A-carboxylase is the key enzyme in the catabolism of odd-chain fatty acids, isoleucine, threonine, methionine and valine [18]. Phosphatidylinositol is an important lipid, both as a key membrane constituent and as a participant in essential signaling processes in all plants and animals. These genes regulate lipid metabolism mainly by enhancing the synthesis of fatty acids. In addition, the expression of genes involved in energy metabolism, such as thioredoxin-like 4B, 5-oxoprolyl-peptidase, etc., were markedly down-regulated in fat line chickens, and the expression of genes participating in gluconeogenesis or glycolysis, including glycerol kinase (GK), ATPase, beta 1,3-galactosyltransferase etc. were up-regulated in this line. In fact, it is well recognized that both energy metabolism [19] and glycometabolism [20,21] are highly related to obesity.

It is interesting that several genes in the protein tyrosine phosphatase pathway were more highly expressed in fat than in lean chickens: fms-related tyrosine kinase 1, receptor tyrosine kinase flk-1/VEGFR-2, a type III receptor tyrosine kinase, protein tyrosine phosphatase-like, member b, protein-tyrosine phosphatase MEG2, etc. This indicates that the protein tyrosine phosphatase pathway is very important in lipid metabolism, and further research is needed to elucidate the molecular mechanism.

Adipogenesis is promoted by the coordinated expression of many transcription factors [22,23]. De-differentiation, or loss of the adipocyte phenotype, has been observed in response to tumor necrosis factor and transforming growth factor β [24,25]. We also observed that several genes involved in tumorigenesis were differentially expressed between the two chicken lines. Expression of genes that inhibit tumorigenesis, such as tumor necrosis factor, alpha-induced protein 1, suppression of tumorigenicity 7 and thrombospondin 1, was down-regulated in fat line chickens, while the expression of genes promoting tumor formation, including ret proto-oncogene and turban tumor syndrome, was up-regulated. This indicates that tumorigenesis may be related to obesity. TNFAIP1 was first identified as a tumor necrosis factor a (TNFa) and interleukin-6(IL-6) inducible protein. It is induced rapidly and transiently by TNFa [26]. It is inferred that the in vivo effects of LPS on lipid metabolism are probably mediated by TNFa, which could be secreted by macrophages or by the adipose tissue itself [27,28]. Albalat et al. [29] suggested that TNFa could be a key modulator of lipid metabolism in fish. Taking these reports and our data into consideration, we presume that TNFa may play a significant role in chicken lipid metabolism.



Conclusion

In conclusion, the chicken adipose tissue gene expression profile was investigated comprehensively in the present study, and specific genes that were differentially expressed in adipose tissue between a fat and a lean chicken line were identified with the aid of the Chicken Genome Array. Genes with high and low expression levels and "not-expressed" genes were identified, and 230 genes that were differentially expressed between the two chicken lines were screened out and confirmed by real-time RT-PCR. These genes were mainly involved in lipid metabolism, energy metabolism, signal transduction, tumorigenesis and immunity. Further analysis indicated that the pyruvate dehydrogenase complex, propionyl-coenzyme A-carboxylase, TNFa and the protein tyrosine phosphatase pathway may play key roles in lipid metabolism. If confirmed in future studies, these patterns of gene expression may contribute to understanding the molecular mechanism of obesity in chickens and provide potential targets for future therapy in humans.


Methods

Lean and fat chicken lines

The NEAU broiler lines divergently selected for abdominal fat content (NEAUHLF) have been selected since 1996 using percentage abdominal fat (%AFW) and plasma very low-density lipoprotein (VLDL) concentration as selection criteria. The G0 generation of the two lines came from the same grandsire line originating from the Arbor Acres breed, which was then divided into two lines according plasma VLDL concentration at 7 weeks. From G1 to G8, birds of each line were raised in two hatches. They were kept in similar environmental conditions and had access to feed and water ad libitum, and were fed with a commercial corn-soybean-based diet that met all NRC requirements (National Research Council, 1994). From hatching to 3 weeks the birds received a starter feed (3,100 kcal ME/kg and 210 g/kg CP), and from 4 weeks to slaughter they were fed a grower diet (3,000 kcal ME/kg and 190 g/kg CP). Plasma VLDL concentrations were measured for all birds at 7 weeks. Abdominal fat weight (AFW) of the male birds in the first hatch was measured and adjusted (%AFW) for body weight (BW) after slaughtering at 7 weeks. Birds with plasma VLDL concentration and AFP lower (lean line) or higher (fat line) than the population average value were selected as candidates for breeding, considering the body weights of male birds and egg production of female birds.

Selection was continued for 8 generations, with 15 sires and 4 hens per sire in the fat line and 10 sires and 4 hens per sire in the lean line for the G0 to G5 generation, then 25 sires and 4 dams per sire in each line for generations G6 through G8. The phenotypic correlation coefficient between body weight and AFW is 0.3789 (P

Sample preparation

Birds were slaughtered at 7 weeks and abdominal fat was isolated, immediately frozen in liquid nitrogen and stored at -80°C. The ten birds used in the present study were chosen by the percentage of abdominal fat (AFP): five had the highest AFP and the other five had the lowest (Table 1). Total RNA was extracted from 300 to 800 mg bulk abdominal adipose tissue using an RNeasy Lipid Tissue Mini Kit (QIAGEN, Valencia, CA) according to the manufacturer's recommendations, and quantified by spectrophotometry. mRNA was isolated using an Oligotex mRNA Mini Kit (QIAGEN, Valencia, CA). cDNA was prepared by oligo-dT-primed reverse transcription using Superscript II (Life Technologies, Inc.). Labeled cRNA probes were prepared using an IVT Labeling Kit (Affymetrix, Inc.) according to the manufacturer's protocol.

Microarrays, hybridization and scanning

The GeneChip Chicken Genome Array used in present study was created by Affymetrix Inc. at the end of 2004, with comprehensive coverage of over 38,000 probe sets representing 32,773 transcripts corresponding to over 28,000 chicken genes. The Chicken Genome Array also contains 689 probe sets for detecting 684 transcripts from 17 avian viruses. Sequence information for this array was selected from the following public data sources: GenBank, UniGene (Build 18; May, 2004) and Ensembl (version 1, released on May, 2004).

Twenty micrograms of cRNA were fragmented at 94°C for 35 min in a 5 × fragmentation buffer containing 200 mM Tris-acetate (pH 8.1), 500 mM KOAc, 150 mM MgOAc. Prior to hybridization, the fragmented cRNA was heated at 95°C for 5 min in 1 × MES hybridization buffer (100 mM MES, 1 M NaCl, 20 mM EDTA, 0.01% Tween20) and 0.1 mg/ml herring sperm DNA, then at 45°C for 5 min, before loading on to the Affymetrix probe array cartridge (Affymetrix, Inc.). After prehybridization in 300 μl 1 × Hybridization Buffer at 45°C for 10 min, the Chicken Genome Arrays were incubated for 16 h at 45°C at constant rotation (60 rpm) using the manufacturer's hybridization buffer. Following hybridization, the arrays were washed with 6 × SSPE-T (0.9 M NaCl/60 mM NaH2PO4/6 mM EDTA/0.01% Tween20) at 25°C on a fluidics station (Affymetrix) for 10 × 2 cycles, then washed with 0.1 M MES/0.1 M NaCl/0.01% Tween20 at 50°C for 4 × 15 cycles. The arrays were stained with a streptavidin-phycoerythrin conjugate (Molecular Probes, Eugene, OR), followed by 10 × 4 wash cycles. To enhance the signals, the arrays were further stained with anti-streptavidin antibody for 10 min followed by a 10-minute staining with the streptavidin-phycoerythrin conjugate. After 15 × 4 additional wash cycles, the arrays were scanned at 560 nm using a confocal scanner (Affymetrix Gene array Scanner3000).

Microarray data normalization

Raw data sets were normalized to total fluorescence, which represents the total amount of cRNA hybridized to a microarray, using the software Affymetrix Microarray Suite 4.0. Data sets were excluded if the absolute call (Abs Call) was A (absent) or M (Marginal) according to the detection p-value in all arrays. Only expressed transcripts (the Abs Call was P, present) were used in further analysis.

The raw data have been deposited in the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus and have been assigned the following GEO accession numbers: GSM197816, GSM197817, GSM197818, GSM197819, GSM197820, GSM197821, GSM197822, GSM197823, GSE197824 and GSE197825

Analysis of gene expression profile in 7-week broilers

The gene expression profile was investigated by three methods. First, according to the data normalization and Affymetrix Microarray Suite 4.0 software results, a gene was considered "not detected" by the scanner if its absolute call was A; we call these genes "not expressed" in this paper. The distribution of the expressed transcript (the Abs Call was P) was characterized by JMP4.0 according to its expression level, and genes with high and low expression levels were defined on the basis of this result.

Hierarchical clustering analysis of the variation within each line

The fat and lean chicken lines have been selected for eight generations, so it is expected that the differences among individuals within each line are slight. Hierarchical clustering analysis of the genes expressed in five birds from each line was conducted to measure the consistency within each line. The value of R (coefficient correlation) was calculated and used to evaluate inter-line variation. Any individual that deviated too much from the others was excluded from the subsequent screening for differentially expressed genes.

Identification of differentially expressed genes

Differentially expressed genes were identified from normalized data using the Significance Analysis of Microarrays (SAM) algorithm [8] implemented in a TIGR MultiExperiment Viewer. According to the SAM algorithm, genes are identified as differentially expressed on the basis of expression differences among the sample groups and the consistency of these differences; a score is assigned to each gene on the basis of a change in its expression relative to the standard deviation of repeated measurements for that gene. A gene is deemed 'significant' if its score surpasses a certain threshold. SAM calculates a false discovery rate (FDR), which is the median percentage of genes that are likely to be identified as significantly changed by chance. The threshold can be adjusted to identify different sets of putatively significant genes and the FDR is changed accordingly. The number of significantly changed genes in each experiment depends on a threshold with an acceptable FDR, selected by the investigator [8,30,31]. Clustering was achieved using uncentered Pearson correlations and average linkage clustering, and was displayed in TreeView. In the present study, a ?-value of 0.8 was chosen, giving a reasonable cutoff of 3.13 and 4.73 in d-scores.

Real-time quantitative RT-PCR

Oligonucleotide primers were designed to amplify a fragment containing sequences from two adjacent exons in order to avoid contamination with genomic DNA. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was considered to be a stably expressed housekeeping gene and was used as an internal reference gene. The primer pairs used to analyze gene expression and the size of product are shown in Table 6.

cDNA was prepared using an RNA PCR Kit (AMV) Ver3.0 (Takara) starting with 500 ng of total RNA from the following samples: (1) fat line: 7-3-3, 7-3-8, 7-3-15, 7-3-16, 7-3-24; (2) lean line: 7-1-1, 7-1-2, 7-1-4, 7-1-11, 7-1-17; (3) four RNA pools (two from each line), each containing three samples that were not used for the array experiments. First-strand cDNA synthesis was performed at 42°C for 30 min. The 10 μl reaction mixture also contained 1 × AMV reaction buffer, 1 mM each dNTP, 0.125 pmol oligo-dT-adaptor primer, 5 mM MgCl2, 10 U RNase inhibitor, and 2.5 U avian myeloblastosis virus (AMV) reverse transcriptase XL. After incubation, the mixture was heated at 99°C for 5 min to extinguish reverse transcriptase activity. Relative quantification of the expression of selected genes was performed using SYBR® Premix Ex Taq™ (Takara). The reaction mixtures were incubated in an ABI Prism 7300 Sequence Detection System (Applied Biosystems) programmed to conduct one cycle at 95°C for 10 s and 40 cycles at 95°C for 5 s and 60°C for 31 s. The dissociation curves were analyzed using Dissociation Curve 1.0 software (ABI) for each PCR reaction to detect and eliminate possible primer-dimer artifacts. Results (fold changes) were expressed as 2ΔΔCt with ΔΔCt = (Ctij - CtGAPDHj) - (Cti1 - CtGAPDH1), where Ctij and CtGAPDHj are the Ct for gene i and for GAPDH in a pool or a sample (named j), and Cti1 and CtGAPDH1 are the Ct in pool 1 or sample 1, expressed as the standard [9].


Abbreviations

ACO: acyl-CoA oxidase; ACX3: acyl-CoA oxidase; AFW: abdominal fat weight; AFP: percentage of abdominal fat; ApoB: apolipoprotein B; ATXN3: ataxin 3; BW: body weight; CCK: cholecystekinin; CCKR: cholecystekinin receptor; CWF19L2: CWF19-like 2, cell cycle control (S. pombe); ERO1: similar to endoplasmic reticulum oxidoreductin 1-Lbeta; FABP: fatty acid binding protein; FLT1: fms-related tyrosine kinase 1; G3PD: glycerol-3-phosphate dehydrogenase 2; IGF2: insulin-like growth factor 2; IGFBP7: insulin-like growth factor binding protein 7; LPL: lipoprotein lipase; LRP12: low density lipoprotein-related protein 12; NEAU: Northeast Agricultural University; PARVA: parvin, alpha; PBP2: similar to 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase gamma 2; PCC: propionyl-coenzyme A-carboxylase; PER: prostaglandin E receptor 3; SAM : Significance Analysis of Microarrays; SOCS7: Suppressor of cytokine signaling 7; Spot14: thyroid hormone-responsive protein; SREBP: sterol regulatory element binding proteins; ST7: suppression of tumorigenicity 7; Stxbp4: similar to Stxbp4 protein; TNFAIP1: Tumor necrosis factor, alpha-induced protein 1.


References

1.   Hillier LW, Miller W, Birney E, Warren W, Hardison RC, Ponting CP, Bork P, Burt DW, Groenen MA, Delany ME, Dodgson JB, Chinwalla AT, Cliften PF, Clifton SW, Delehaunty KD, Fronick C, Fulton RS, Graves TA, Kremitzki C, Layman D, Magrini V, McPherson JD, Miner TL, Minx P, Nash WE, Nhan MN, Nelson JO, Oddy LG, Pohl CS, Randall-Maher J, Smith SM, Wallis JW, Yang SP, Romanov MN, Rondelli CM, Paton B, Smith J, Morrice D, Daniels L, Tempest HG, Robertson L, Masabanda JS, Griffin DK, Vignal A, Fillon V, Jacobbson L, Kerje S, Andersson L, Crooijmans RP, Aerts J, van der Poel JJ, Ellegren H, Caldwell RB, Hubbard SJ, Grafham DV, Kierzek AM, McLaren SR, Overton IM, Arakawa H, Beattie KJ, Bezzubov Y, Boardman PE, Bonfield JK, Croning MD, Davies RM, Francis MD, Humphray SJ, Scott CE, Taylor RG, Tickle C, Brown WR, Rogers J, Buerstedde JM, Wilson SA, Stubbs L, Ovcharenko I, Gordon L, Lucas S, Miller MM, Inoko H, Shiina T, Kaufman J, Salomonsen J, Skjoedt K, Wong GK, Wang J, Liu B, Wang J, Yu J, Yang H, Nefedov M, Koriabine M, Dejong PJ, Goodstadt L, Webber C, Dickens NJ, Letunic I, Suyama M, Torrents D, von Mering C, Zdobnov EM, Makova K, Nekrutenko A, Elnitski L, Eswara P, King DC, Yang S, Tyekucheva S, Radakrishnan A, Harris RS, Chiaromonte F, Taylor J, He J, Rijnkels M, Griffiths-Jones S, Ureta-Vidal A, Hoffman MM, Severin J, Searle SM, Law AS, Speed D, Waddington D, Cheng Z, Tuzun E, Eichler E, Bao Z, Flicek P, Shteynberg DD, Brent MR, Bye JM, Huckle EJ, Chatterji S, Dewey C, Pachter L, Kouranov A, Mourelatos Z, Hatzigeorgiou AG, Paterson AH, Ivarie R, Brandstrom M, Axelsson E, Backstrom N, Berlin S, Webster MT, Pourquie O, Reymond A, Ucla C, Antonarakis SE, Long M, Emerson JJ, Betran E, Dupanloup I, Kaessmann H, Hinrichs AS, Bejerano G, Furey TS, Harte RA, Raney B, Siepel A, Kent WJ, Haussler D, Eyras E, Castelo R, Abril JF, Castellano S, Camara F, Parra G, Guigo R, Bourque G, Tesler G, Pevzner PA, Smit A, Fulton LA, Mardis ER, Wilson RK: Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution.Nature 2004, 432:695-716.       2.   Wicker T, Robertson JS, Schulze SR, Feltus FA, Magrini V, Morrison JA, Mardis ER, Wilson RK, Peterson DG, Paterson AH, Ivarie R: The repetitive landscape of the chicken genome.Genome Res 2005, 15:126-136.       3.   Burt DW: Applications of biotechnology in the poultry industry.Worlds Poult Sci J 2002, 58:5-13.       4.   Nones K, Ledur MC, Ruy DC, Baron EE, Melo CM, Moura AS, Zanella EL, Burt DW, Coutinho LL: Mapping QTLs on chicken chromosome 1 for performance and carcass traits in a broiler x layer cross.Anim Genet 2006, 37:95-100.       5.   Havenstein GB, Ferket PR, Scheideler SE, Rives DV: Carcass composition and yield of 1991 vs 1957 broilers when fed "typical" 1957 and 1991 broiler diets.Poult Sci 1994, 73:1795-1804.       6.   Kessler AM, Snizek PN Jr, Brugalli I: Manipulação da quantidade de gordura na carcaça de frangos In: Anais da Conferência APINCO de Ciência e Tecnologia Avícolas.APINCO, Campinas, SP, Brazil Press; 2000.       7.   Chambers JR: Genetics of growth and meat production in chickens.In Poultry breeding and genetics. Edited by: Crawford RD. Amsterdam: Elsevier Press; 1990       8.   Tusher VG, Tibshirani R, Chu G: Significance analysis of microarrays applied to the ionizing radiation response.Proc Natl Acad Sci USA 2001, 98:5116-5121.       9.   Bourneuf E, Hérault F, Chicault C, Carré W, Assaf S, Monnier A, Mottier S, Lagarrigue S, Douaire M, Mosser J, Diot C: Microarray analysis of differential gene expression in the liver of lean and fat chickens.Gene 2006, 372:162-170.       10.   Zhu T: Global analysis of gene expression using GeneChip microarrays.Curr Opin Plant Biol 2003, 6:418-425.       11.   Lockhart DJ, Dong H, Byrne MC, Follettie MT, Gallo MV, Chee MS, Mittman M, Wang C, Kobayashi M, Horton H, Brown EL: Expression monitoring by hybridization to high-density oligonucleotide arrays.Nat Biotechnol 1996, 14:1675-1680.       12.   Saadoun A, Leclercq B: In vivo lipogenesis of genetically lean and fat chickens: effects of nutritional state and dietary fat.J Nutr 1987, 117:428-435.       13.   Rajeevan MS, Vernon SD, Taysavang N, Unger ER: Validation of array-based gene expression profiles by real-time (kinetic) RT-PCR.J Mol Diagn 2001, 3:26-31.       14.   Reed LJ: Regulation of mammalian pyruvate dehydrogenase complex by a phosphorylation-dephosphorylation cycle.Curr Top Cell Regul 1981, 18:95-106.       15.   Reed LJ: A trail of research from lipoic acid to alpha-keto acid dehydrogenase complexes.J Biol Chem 2001, 276:38329-38336.       16.   Martin E, Rosenthal RE, Fiskum G: Pyruvate dehydrogenase complex: metabolic link to ischemic brain injury and target of oxidative stress.J Neurosci Res 2005, 79:240-247.       17.   Lopez IP, Marti A, Milagro FI, Zulet Md Mde L, Moreno-Aliaga MJ, Martinez JA, De Miguel C: DNA microarray analysis of genes differentially expressed in diet-induced (cafeteria) obese rats.Obes Res 2003, 11:188-194.       18.   Van Greevenbroek MM, Vermeulen VM, De Bruin TW: Identification of novel molecular candidates for fatty liver in the hyperlipidemic mouse model, HcB19.J Lipid Res 2004, 45:1148-1154.       19.   Labib M: The investigation and management of obesity.J Clin Pathol 2003, 56:17-25.       20.   Sun Y, Liu S, Ferguson S, Wang L, Klepcyk P, Yun JS, Friedman JE: Phosphoenolpyruvate carboxykinase overexpression selectively attenuates insulin signaling and hepatic insulin sensitivity in transgenic mice.J Biol Chem 2002, 277:23301-23307.       21.   Boden G, Cheung P, Stein TP, Kresge K, Mozzoli M: FFA cause hepatic insulin resistance by inhibiting insulin suppression of glycogenolysis.Am J Physiol Endocrinol Metab 2002, 283:E12-19.       22.   MacDougald O, Lane M: Transcriptional regulation of gene expression during adipocyte differentiation.Annu Rev Biochem 1995, 64:345-373.       23.   Gregoire F, Smas CM, Sul HS: Understanding adipocyte differentiation.Physiol Rev 1998, 78:783-809.       24.   Ron D, Brasier AR, McGehee RE, Habener JF: Tumor necrosis factor-induced reversal of adipocyte phenotype of 3T3-L1 cells is preceded by a loss of nuclear CCAAT/Enhancer binding protein (C/EBP).J Clin Invest 1992, 89:223-233.       25.   Nadler ST, Stoehr JP, Schueler KL, Tanimoto G, Yandell BS, Attie AD: The expression of adipogenic genes is decreased in obesity and diabetes mellitus.Proc Natl Acad Sci USA 2000, 97:11371-11376.       26.   Wolf FW, Marks RM, Sarma V, Byers MG, Katz RW, Shows TB, Dixit VM: Characterization of a novel tumor necrosis factor-alpha-induced endothelial primary response gene.J Biol Chem 1992, 267(2):1317-1326.       27.   Sewter CP, Digby JE, Prins J, O'Rahilly S: Regulation of tumor necrosis factor-alpha release from human adipose tissue in vitro.J Endocrinol 1999, 163:33-38.       28.   MacKenzie S, Planas JV, Goetz FW: LPS-stimulated expression of a tumor necrosis factor-alpha mRNA in primary trout monocytes and in vitro differentiated macrophages.Dev Comp Immunol 2003, 27:393-400.       29.   Albalat A, Liarte C, MacKenzie S, Tort L, Planas JV, Navarro I: Control of adipose tissue lipid metabolism by tumor necrosis factor-alpha in rainbow trout (Oncorhynchus mykiss).J Endocrinol 2005, 184:527-534.       30.   Chowers I, Gunatilaka TL, Farkas RH, Qian J, Hackam AS, Duh E, Kageyama M, Wang C, Vora A, Campochiaro PA, Zack DJ: Identification of novel genes preferentially expressed in the retina using a custom human retina cDNA microarray.Invest Ophthalmol Vis Sci 2003, 44:3732-3741.       31.   Hedtjarn M, Mallard C, Eklind S, Gustafson-Brywe K, Hagberg H: Global gene expression in the immature brain after hypoxia-ischemia.J Cereb Blood Flow Metab 2004, 24:1317-1332.    


Figures

..................................................

Figure 1 The separation of AFP between fat and lean lines. The lean and fat chicken lines derived from a commercial Arbor Acres (AA) grandsire line were created at the Northeast Agricultural University Animal Breeding Center in 1996. They have been selected for 8 generations up to 2004. The selection criteria were the proportion of abdominal fat and levels of very low density lipoproptein (VLDL) in males at 7 weeks of age. Significant differences in AFW and AFP between the two lines were apparent from the 4th generation. Selection was continued for 8 generations, with 15 sires and 4 hens per sire in each line for the G0 to G5 generations and 25 sires and 4 dams per sire in each line for generations G6 to G8. The number of fat line chickens from G1 to G8 was: 82, 88, 75, 81, 80, 78, 179, 165, respectively; and in lean line from G1 to G8: 124, 133, 127, 141, 139, 145, 258, 219, respectively. G represents generation. **p

..................................................

Figure 2 Comparison of BW, AFW and AFP in chickens used in the study. The birds were kept in similar environmental conditions and had access to feed and water ad libitum, and were fed with a commercial corn-soybean-based diet that met all NRC requirements for 7 weeks. BW was measured after 12 hours fasting, then the birds were slaughtered and the abdominal fat was isolated and weighed. The AFP was calculated as AFP (%) = AFW (g)/BW (g). BW, AFW and AFP data for the ten birds are shown in Table 1. BW is not significantly different between the two lines, but AFW and AFP differ significantly. Data are mean ± SD (n = 5). **p

..................................................

Figure 3 The distribution of genes expressed in adipose tissue calculated by JMP. Raw data sets were normalized to total fluorescence, which represents the total amount of cRNA hybridized to a microarray using the software Affymetrix Microarray Suite 4.0. Data sets were excluded if the absolute call (Abs Call) was A (absent) or M (Marginal) according to the detection p-value in all arrays. Only expressed transcripts (the Abs Call was P, present) were used in the analysis. The y-axis is the signal intensity after normalization, which represents the relative expression level of genes. The signal intensity of most genes was under 10,000, that most genes are poorly expressed in chicken adipose tissue at 7 weeks.

..................................................

Figure 4 The hierarchical clustering results of five fat line and five lean line chickens. A: hierarchical clustering results for five fat line chickens. B: hierarchical clustering result for five lean line chickens. The data used for clustering were normalized data that excluded the "not expressed" genes. R represents the coefficient of correlation among individuals. The fat chicken line shared about 87% consistency, while the lean chicken line shared about 77% consistency. Sample 7-3-16 shared only 59% consistency with the other fat line chickens, so it was excluded from the subsequent screening of differentially expressed genes.

..................................................

Figure 5 SAM Plot for Delta = 0.8. Differentially expressed genes were identified from normalized data using the Significance Analysis of Microarrays (SAM) algorithm implemented in a TIGR MultiExperiment Viewer. A cutoff value delta, depending on an arbitrary false positive rate, was chosen to identify significantly differentially expressed genes. For this analysis, a delta value of 0.8 was used, giving a reasonable cutoff of 3.13 and 4.73 in d-scores.

..................................................

Figure 6 Cluster image of 230 significant differentially expressed genes. A total of 230 differentially expressed genes were identified by SAM algorithm: 153 were up-regulated and 77 were down-regulated in fat chickens compared to lean chickens. Colored bars indicate relative expression levels. Genes that are expressed at higher levels are assigned progressively brighter shades of red, while genes expressed at low levels are assigned shades of green.

..................................................

 


Tables

Table 1
BW, AFW and AFP of chickens used in the study

Fat line
Lean line

7-3-3
7-3-8
7-3-15
7-3-16
7-3-24
7-1-1
7-1-2
7-1-4
7-1-11
7-1-17
BW(g)
2690
2615
2915
2940
2895
2655
2655
2080
2375
2685
AFW(g)
103.4
116.6
115.3
112.1
138.4
36.91
40.13
28.27
23.46
40.83
AFP (%)
3.84
4.46
3.96
3.81
4.78
1.39
1.51
1.36
0.99
1.52
Table 2
Some highly expressed genes in chicken adipose tissue at 7 weeks

The signal intensity analyzed by scanner
Genes
Fat line
Lean line


7-3-3
7-3-8
7-3-15
7-3-16
7-3-24
7-1-1
7-1-2
7-1-4
7-1-11
7-1-17
A-FABP
44732
47715
46157
57201
52558
52286
49813
51861
50529
47910
spot 14
33917
30120
28795
35261
36359
19983
25819
24245
31674
31015
LPL
27133
24469
29421
25855
30799
18393
20950
23462
25275
23246
IGFBP-7
20471
22532
21163
27799
24675
24113
25764
29104
26375
28610
BMP7
29042
30313
25289
25124
22610
15932
24165
13953
26518
33345
hsp70
33480
32478
30641
21373
23217
19213
21624
16512
21503
30312
PCHK23
21402
19941
19423
30817
30956
29866
25764
24882
22561
25995
hsp25
32908
19470
23662
21037
25644
19327
7967
22002
19564
27742
glutathione peroxidase 4
22459
21447
24945
23085
24229
18705
23685
27400
27560
24096
stem cell antigen 2
32224
31256
22169
24894
26446
21403
27675
24483
26370
26105
CD74 gene
45284
38191
36116
38875
37099
43381
38466
32027
40065
39493
Vimentin
38624
36822
37965
33403
35772
36159
40251
41728
40184
40972
ubiquitin C
42501
37306
45125
39121
35707
35202
40535
42767
43055
41982
Thymosin beta 4
35340
33804
38768
34644
30105
42836
37625
34939
36087
37120
MCH II antigen B-L Beta
32147
29581
28406
34359
28741
38580
30089
29337
28674
31680
T-cell leukemia, homeobox 3
26240
29169
34325
24093
24060
36533
29476
28294
28493
31986
platelet/endothelial cell adhesion molecule
21515
16459
10731
12262
13868
16684
18476
17751
14270
17975
Table 3
Some poorly expressed genes in chicken adipose tissue at 7 weeks

The signal intensity analyzed by scanner
Genes
Fat line
Lean line


7-3-3
7-3-8
7-3-15
7-3-16
7-3-24
7-1-1
7-1-2
7-1-4
7-1-11
7-1-17
IGF-I
5.7
11.3
91
7
5.8
52
27.6
22.7
46.6
91.6
UCP
43.3
87.1
104.2
130
119.4
122.2
818.2
289.2
159.6
150.6
APOVLDLII
140.1
103
75.8
107.3
156.2
298.3
72.5
22.6
143.8
98.4
L-FABP
57.7
70.6
126.9
32.6
128.3
623.8
844.5
88.8
52.4
4865
TGFa
115.1
216.8
79.8
51
94.3
186.6
37.7
49.7
166.1
95.8
TGFβR
82.3
151.7
83.3
153.6
146
279.6
166.3
221.9
140.6
191.4
PEPCK-M
503.8
206.3
326
38.1
117.3
404.2
154.2
150.5
140
198.6
BMP2
236
355.4
262.7
317.2
430.9
209.3
399.6
228.6
337
208.6
acetyl-coenzyme A carboxylase alpha
232.5
181.8
319.5
396.4
172.9
181.7
160.8
207.1
144.9
111.8
type I TGF β receptor
82.3
146
153.6
83.3
151.7
191.4
140.6
221.9
279.6
166.3
cAMP response element- binding protein
96.9
115.5
132.3
75
146.5
171.6
91
82.7
196.4
132.6
hexokinase 2 (HK2)
270.3
458.9
526.4
779.8
287.3
523
471.5
337.2
294.7
398.3
Proinsulin
263
269.5
361
540.1
293
336
311
411.1
422.6
190.2
GDF-9
198.1
197.8
216.7
413
190.7
246.8
151.7
110.6
262.9
147.2
BMP5
216.3
382.1
179.5
241.8
257.8
132.2
282.2
264.5
173
288.6
mitogen-activated protein kinase phosphatase 2
231.5
288.2
247.1
238.6
280.5
239.6
136.8
415.3
300.7
205.1
(MKP-2) riboflavin-binding protein
239.7
17.6
179
75.8
242.5
139.8
424.4
60.8
129.9
291.4
Table 4
Some "not expressed" genes in adipose tissue of 7-week-old chickens
Probe set ID
Genes
mismatching probes pairs/the total probes pairsa
Gga.10702.1.A1_at
insulin-like growth factor 2
10/10
Gga.11305.1.S1_s_at
thyroid hormone receptor associated protein 2
10/10
Gga.11817.1.S1_s_at
apolipoprotein B
10/10
Gga.12348.2.S1_a_at
glycosyltransferase
10/10
Gga.13.1.S1_s_at
leptin receptor
10/10
Gga.4123.1.S1_at
lipoprotein (APOVLDLII)
10/10
Gga.1731.1.S1_at
pyruvate carboxylase
10/10
Gga.742.1.S1_at
somatostatin-14
10/10
Gga.1267.1.S1_a_at
growth hormone 1
10/10
Gga.560.1.S1_at
growth differentiation factor 8
10/10
Gga.5646.2.S1_at
diacylglycerol kinase, zeta 104 kDa
10/10
GgaAffx.21833.1.S1_s_at
cholecystokinin receptor
10/10
GgaAffx.21834.1.S1_s_at
cholecystokinin
10/10
GgaAffx.21846.1.S1_s_at
transforming growth factor alpha
10/10
GgaAffx.2229.1.S1_at
polyamine oxidase (exo-N4-amino)
10/10
Gga.579.1.S1_at
neurotrophic tyrosine kinase, receptor, type 1
10/10
Gga.609.1.S1_at
thyroid hormone receptor beta 2
10/10
Gga.151.1.S1_at
sterol regulatory element binding transcription factor 1
10/10
Gga.686.1.S1_at
bone morphogenetic protein 4
10/10
Gga.689.1.S1_at
low density lipoprotein-related protein 1
10/10
Gga.15741.1.S1_at
growth arrest-specific 2
10/10
Gga.16782.1.S1_at
phosphoinositide-3-kinase, catalytic
10/10
Gga.761.1.S1_at
Mel-1c melatonin receptor
10/10
Gga.762.1.S1_at
melatonin receptor 1
10/10
Gga.784.1.S1_at
protein-tyrosine phosphatase CRYPalpha
10/10
Gga.793.1.S1_s_at
acetylcholinesterase
10/10
Gga.811.1.S1_at
growth differentiation factor 2
10/10
Gga.17381.1.S1_at
phospholipase C-like 3
10/10
Gga.857.1.S1_at
epidermal growth factor receptor
10/10
Gga.6214.1.S1_a_at
phospholipase A2, group IB (pancreas)
10/10
Gga.3663.2.S1_at
nucleolin
10/10
Gga.3707.2.A1_at
CCAAT/enhancer binding protein (C/EBP), gamma
10/10
GgaAffx.2229.1.S1_at
polyamine oxidase (exo-N4-amino)
10/10
GgaAffx.3695.1.S1_s_at
myelin transcription factor 1
10/10
GgaAffx.3803.6.S1_at
plexin A1
10/10
Gga.2645.1.S1_at
transforming growth factor, beta receptor II
10/10
Gga.2694.1.S1_at
lymphoid enhancer-binding factor 1
10/10
Gga.271.1.A1_at
bone morphogenetic protein 1
10/10
Gga.2933.1.S1_at
N-acetylglucosaminyltransferase VI
10/10
GgaAffx.20398.1.S1_s_at
phospholipase C-like 3
10/10
a: mismatching probes pairs in the total probes (10 pairs) that represent certain genes.
Table 5
Differentially expressed genes by microarray analysis
Probe set ID
Fold Change (fat/lean)
T-test P-value
SAM q-value
Chr. Location
GenBank ID
Gene name
Lipid Metabolism






GgaAffx.24836.1.S1_at
2.5
0.001
0.27
chr1: 100587339–100699482
XM_416725
propionyl-Coenzyme A-carboxylase
GgaAffx.22084.1.S1_at
1.8
0
0.27
chr11: 59355–69450
No record
lysophospholipase 3
Gga.150.1.S1_at
4.2
0.003
0.279
chr1: 167849591–167950628
NM_204252
fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)
GgaAffx.8095.1.S1_at
1.6
0.006
0.324
chr1: 52216531–52245657
XM_416329
N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Gga.879.1.S1_at
-6.7
0.001
0.27
chr11: 16001674–16006281
NM_205526
N-acetyltransferase
Gga.19791.1.S1_s_at
1.9
0.003
0.279
chr2: 128797196–128808892
XM_418378
low density lipoprotein-related protein 12
GgaAffx.9942.1.S1_at
2.2
0.001
0.27
chr4: 81245396–81273837
XM_420814
acyl-CoA oxidase
GgaAffx.20938.1.S1_at
1.3
0.007
0.329
chr5: 15830450–15831289
NM_001031187
pyruvate dehydrogenase complex, component X similar to glycerol-3-phosphate dehydrogenase 2;
GgaAffx.23939.1.S1_s_at
7.5
0.005
0.301
chr7: 36699654–36750512
XM_422168
glycerol phosphate dehydrogenase 1, mitochondrial; FAD-linked glycerol-3-phosphate dehydrogenase
Gga.17037.1.S1_s_at
1.6
0.005
0.308
chrZ: 15403025–15434404
NM_001031422
phosphatidylinositol-4-phosphate 5-kinase, type I, beta
GgaAffx.5721.1.S1_at
2.1
0.001
0.27
chr3: 9206064–9214413
NM_001031039
lysocardiolipin acyltransferase
Energy Metabolism






Gga.11825.1.S1_at
3.2
0.003
0.274
chr1: 109208120–109232230
XM_416788
glycerol kinase
Gga.9828.1.S1_a_at
-3.2
0
0.27
chr1: 79394222–79396236
XM_416612
thioredoxin-like 4B
GgaAffx.4389.1.S1_at
-1.6
0.004
0.284
chr10: 17276047–17283495
XM_425083
5-oxoprolyl-peptidase
GgaAffx.2243.2.S1_at
2.3
0.002
0.27
chr26: 3685185–3702282
XM_418055
ATPase, Ca++ transporting, plasma membrane 4
Gga.19534.1.S1_at
8.3
0.002
0.27
chr9: 21559961–21563214
">XM_422814">
beta 1,3-galactosyltransferase, polypeptide 3
Tumorigenesis






Gga.6519.1.S1_s_at
-2.2
0.005
0.303
chr1: 21687403–21784133
XM_416014
suppression of tumorigenicity 7
Gga.15871.1.S1_at
-1.6
0.006
0.323
chr19: 8852117–8853712
CR387378
Tumor necrosis factor, alpha-induced protein 1
Gga.12058.1.S1_at
2.1
0.003
0.279
chr2: 135144222–135145306
XM_418407
similar to cylindromatosis (turban tumor syndrome); cylindromatosis 1, turban tumor syndrome
GgaAffx.22987.1.S1_at
-1.6
0.002
0.27
chr5: 26523325–26529591
XM_421205
thrombospondin 1
Gga.654.1.S2_at
1.8
0.001
0.27
chr6: 4237546–4314610
NM_205190
ret proto-oncogene
Signal Transduction






GgaAffx.3663.1.S1_at
-5.3
0.003
0.278
chr14: 8517712–8520620
XM_414857
similar to CASK interacting protein 1
Gga.12193.1.S1_a_at
9.0
0.007
0.324
chr2: 47562155–47581032
XM_418851
G-substrate
Gga.9510.1.S1_at
1.9
0.007
0.329
chr22:537865–569787
NM_001030886
protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoform
Gga.1761.2.S1_at
13.8
0.002
0.27
chr3:107742849–107744353
XM_420066
similar to G-protein coupled receptor 116
GgaAffx.4775.1.S1_s_at
4.0
0.002
0.27
chr4:11707299–11760821
XM_420292
similar to receptor tyrosine kinase flk-1/VEGFR-2
Gga.807.1.S1_at
1.9
0.007
0.324
chr4:65686004–65686340
NM_001004368
kinase insert domain receptor (a type III receptor tyrosine kinase) (KDR)
Gga.12481.1.S1_s_at
1.9
0.007
0.327
chr7:27843665–27860405
NM_001012920
protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b
Gga.6653.1.S1_at
-1.7
0.004
0.281
chr11:17426083–17429654
NM_001030576
hepatic nuclear factor 4beta similar to suppressor of cytokine signaling 7; SH2
GgaAffx.8729.1.S1_s_at
-10.0
0
0.27
chrUn:137141542–137146475
XM_423895
domain containing SOCS box protein SOCS7; Nck, Ash and phospholipase C binding protein similar to prostaglandin E receptor 3; Rat kidney
GgaAffx.7207.1.S1_at
5.7
0.002
0.27
chr8:29278163–29285596
XM_426672
prostaglandin EP3 receptor (alternative splicing results in two different receptors EP3a and EP3b);
Gga.10737.1.S1_s_at
1.7
0.005
0.305
chr7:2212065–2223469
XM_421856
similar to Nck-associated protein 1 (NAP 1) (p125Nap1) (Membrane-associated protein HEM- 2)
GgaAffx.8719.1.S1_at
7.2
0.002
0.27
chr4:64869759–64912904
XM_420693
similar to regulator protein p122-RhoGAP – rat
Gga.12408.3.S1_a_at
2.7
0.005
0.305
chr5:41375030–41383659
NM_204357
ataxin 3
Gga.323.1.S1_at
3.6
0.001
0.27
chrUn:147862083–147882739
NM_204801
tetraspanin 18
Immunity






Gga.13806.1.S1_at
-4.8
0.004
0.293
chr7:7186627–7189336
NM_204240
adenosine deaminase, RNA-specific, B1 (RED1 homolog rat)
Gga.18504.1.S1_at
6.9
0.003
0.278
chr5:5440836–5460278
CR390783
parvin, alpha
Gga.698.1.S1_at
1.6
0.004
0.293
chr6:14652488–14704778
NM_205441
vinculin
Gga.11155.1.S1_s_at
1.8
0.001
0.27
chr4:15341234–15354773
XM_420331
stromal antigen 2
Others






Gga.11258.1.S1_at
1.7
0.001
0.27
chr1:170378838–170513289
XM_417140
EF-hand domain family, member A1
Gga.15085.2.S1_s_at
6.6
0.001
0.27
chr1:172635432–172645292
XM_417167
CWF19-like 2, cell cycle control (S. pombe)
GgaAffx.5969.1.S1_at
6.2
0.002
0.27
chr1:24071401–24234367
XM_416024
similar to dedicator of cytokinesis 4
GgaAffx.12338.1.S1_s_at
3.9
0.001
0.27
chr15:7114454–7122253
NM_001030665
tuftelin interacting protein 11
GgaAffx.25724.1.S1_s_at
7.4
0.002
0.27
chr18:5638526–5691321
XM_415648
similar to Stxbp4 protein
GgaAffx.6849.1.S1_at
4.0
0.004
0.285
chr3:34026676–34050970
XM_419554
similar to endoplasmic reticulum oxidoreductin 1- Lbeta
GgaAffx.22370.3.S1_s_at
4.3
0
0.27
chr3:1260579–1276286
XM_420116
similar to chromosome 17 open reading frame 28; downregulated in multiple cancer 1
GgaAffx.6334.2.S1_at
3.9
0.004
0.293
chr4:33725503–33732138
XM_420444
SH3 domain protein D19
GgaAffx.22790.1.S1_s_at
6.1
0.003
0.279
chr6:26875122–27047419
XM_421771
similar to actin-binding LIM protein 1 medium isoform
GgaAffx.26704.1.S1_at
-5.2
0.001
0.27
chr8:14622890–14638649
XM_422345
similar to abhydrolase domain containing 7
Gga.16560.1.S1_at
3.3
0.003
0.279
chrE26C13:1961–7813
XM_422853
myeloid cell leukemia sequence 1 (BCL2-related)
Gga.16020.1.S1_at
2.2
0
0.27
chrUn:92422001–92432256
NM_001031613
similar to Death-associated protein kinase 1
Table 6
Primer pairs used to analyze gene expression by quantitative RT-PCR, and size of product
Gene
Forward primera
Reverse primera
Size
PCC
AGGGAAAGGTCGTGGCG
CCACTGCCAAGGACACTAGG
137 bp
PBP2
GAGTAAAGTCCGAGAACGAATG
AAATCCAGTAGTGGGACAAAGG
185 bp
TNFAIP1
TTCACTCTTAGAAATGCTGGTG
CTAAGTTAGTGGCAAAGCTGG
169 bp
FLT1
CTCTTTGGCATGAAAGGTGTC
CGTAGGTGTATCTTCGCTTGG
124 bp
G3PD
CTCCCATCCCATACCGACAG
GGCATATCGACTGCGTGTCC
167 bp
LRP12
GGAGTGTCAACGGCTTGTGG
ATCGGCGTGATCCCTGAACA
184 bp
PER
GGATCATGTGCGTCCTGTC
GGAGCAGCAGATAAACCCAC
210 bp
ST7
GTTCTATGTTGCCTTGACAGG
AAGTGGCTCACCGAGACCT
120 bp
ERO1
TTCAAGCCTCGATCTGTCTA
TCAAGAAGATAATTGGCACAC
182 bp
ATXN3
AAAGGTGACCTGCCAGAC
TTGCTTGGTCCACATCAC
142 bp
PARVA
GTGTACTTAGTCCTGCTAATGGG
TCTGGTCTGGGCTTTGGTT
161 bp
CWF19
ATCCCAGGGAAGTCTCGC
CTTTAGGCTCCTGTGGTTCAG
127 bp
Stxbp4
CCAAGATTTGAGAAAGAGGGTT
TCACTTAGAACAGCCGAGGAA
162 bp
ACO
GCTGTGCTCTATCAAGGTGGC
ACAAGGGCAACTGCGTCATC
110 bp
SOCS7
CATCCCAAGTTTGAAGACCG
CATTGCTGAACCTGGAGACG
163 bp
GAPDH
AGAACATCATCCCAGCGT
AGCCTTCACTACCCTCTTG
184 bp
a,: Sequences of oligonucleotides are indicated from 5' to 3' end
Table 7
Comparison of microarray and real-time RT-PCR analyses
Gene
Microarraya
Real-time RT-PCR


Fold change(F/L)b
Fold change(F/L)b
Student T-testc (p-value)
PCC
2.5
2.45
0.0312*
ATXN3
2.7
4.47
0.0241*
PER
5.67
8.08
0.007**
ERO1
3.94
3.66
0.0308*
FLT1
4.21
4.46
0.0455*
CWF19
6.56
1.95
0.03*
PBP2
6.95
5.75
0.0521
PARVA
6.90
3
0.0221*
G3PD
7.46
2.32
0.0154*
Stxbp4
7.35
2.8
0.0031**
LRP12
1.82
8.83
0.0404*
ACO
2.19
2.76
0.2912
ST7
-2.1
-2.07
0.0042**
SOCS7
-10.0
-1.41
0.2117
TNFAIP1
-1.6
1.72
0.0086**
a: Microarray F/L fold changes are taken from Table 5.
b: Fold changes (F/L: mean of fat sample values on mean of lean sample values).
c:Student's t-test p-values, *p

 


http://www.biology-online.org/articles/profiling_chicken_adipose_tissue/abstract.html