Dictionary » S » Sequences

Sequences

sequence

The noun: the order in which subunits appear in a chain, such as amino acids in a polypeptide or nucleotide bases in a dNA or rNA molecule.

The verb: To find out in what order the subunits appear in the chain.


Please contribute to this project, if you have more information about this term feel free to edit this page



Results from our forum


Re: How to read this tricky electropherogram?

Do you know if this is genomic DNA or cDNA? If not, you should BLAST against both the RNA sequences and the genomic DNA sequence.

See entire post
by jonmoulton
Mon Feb 23, 2015 3:50 pm
 
Forum: Molecular Biology
Topic: How to read this tricky electropherogram?
Replies: 1
Views: 520

How to read this tricky electropherogram?

... of ~100 bp segments and searched them in Blast... nothing came up. All what I know is that this is a human gene. Any ideas? Here are the three sequences and the actual graph lane (1) AAAGTGCATCTCCTCCGACATTGGAGGATCCCAAGCTCTCATGTTGCCCTTATTGTCACCAGTGACATTTATTCCAAACAGGAGTCCTTCGGGCCAGCAAA lane (2) ...

See entire post
by kabtq9s
Sat Feb 21, 2015 3:23 am
 
Forum: Molecular Biology
Topic: How to read this tricky electropherogram?
Replies: 1
Views: 520

Upcoming Workshop: A Beginner's Guide to NGS Data Analysis

... and one proceeds with first hands-on analyses (QC, mapping, visualization). You will learn how to read and interprete QC plots, clip adapter sequences and/or trim bad quality read ends, get bioinformatics backgrounds about the read mapping and understand its problems (dynamic programming, ...

See entire post
by ecSeq
Fri Jan 23, 2015 5:44 pm
 
Forum: Bioinformatics
Topic: Upcoming Workshop: A Beginner's Guide to NGS Data Analysis
Replies: 0
Views: 326

Re: Any ideas for vaccine development or anti-viral drugs???

... for interfering with EBOV infection using antisense phosphorodiamidate morpholino oligomers (PMOs). A combination of EBOV-specific PMOs targeting sequences of viral mRNAs for the viral proteins (VPs) VP24, VP35, and RNA polymerase L protected rodents in both pre- and post-exposure therapeutic ...

See entire post
by jonmoulton
Mon Sep 15, 2014 3:04 pm
 
Forum: Cell Biology
Topic: Any ideas for vaccine development or anti-viral drugs???
Replies: 2
Views: 12575

convert human DNA into RNA and use a retro virus...

... extraction) and put it into a genetically modified retro virus and inject it into yourself or other people? And if you have some broken genes sequences and you decide to extract your DNA and fix that problem (if it's possible to fix) and use the method with the retro virus above? Sorry for ...

See entire post
by Accelerator
Sat Sep 13, 2014 2:21 pm
 
Forum: Microbiology
Topic: convert human DNA into RNA and use a retro virus...
Replies: 0
Views: 1077
View all matching forum results

This page was last modified 21:16, 3 October 2005. This page has been accessed 6,095 times. 
What links here | Related changes | Permanent link