Sense strand

For this mRNA: AAGGGUGUAGAAGCUAAGGGU The antisense is likely: ACCCTTAGCTTCTACACCCTT The sense is likely: AAGGGTGTAGAAGCTAAGGGT ... be a pre-mRNA splicing event within the sequence that produces the mature mRNA strand. If so, the DNA sequence would be interrupted by an intron. If there is no ...

See entire post

... type of Holliday junction? How is that possible, that two not identical strands from two different molecules join together? I think that there may ... crossing lines and arrows here in the book and can't really make much sense of it. If it's not possible to give me siple instructions I would be ...

See entire post

... its only certain chapters. so it goes from like ch 5-23. crazy. so when it asks to include the polarity, what is it asking. tell which end of the strand is 5 and which is 3?

See entire post

... the tRNA molecules that were used for its translation and the anti-sense strand of the DNA. Be sure to include polarity of all items.... Ok I have the final products ...

See entire post

... science like this all adding up to what it does. You know it makes sense but with natural selection not needed for the theory to stand on its ... to put all the files that can be dowloaded from the RegulonDB that have strand and location are put into genome. Also wrote another that from that ...

See entire post