Dictionary » S » Sad

Sad

sad

1. Sated; satisfied; weary; tired. Yet of that art they can not waxen sad, For unto them it is a bitter sweet. (Chaucer)

2. Heavy; weighty; ponderous; close; hard. His hand, more sad than lump of lead. (Spenser) Chalky lands are naturally cold and sad. (Mortimer)

3. Dull; grave; dark; somber; said of colours. Sad-coloured clothes. Woad, or wade, is used by the dyers to lay the foundation of all sad colours. (Mortimer)

4. Serious; grave; sober; steadfast; not light or frivolous. Ripe and sad courage. Which treaty was wisely handled by sad and discrete counsel of both parties. (ld. Berners)

5. Affected with grief or unhappiness; cast down with affliction; downcast; gloomy; mournful. First were we sad, fearing you would not come; Now sadder, that you come so unprovided. (Shak) The angelic guards ascended, mute and sad. (milton)

6. Afflictive; calamitous; causing sorrow; as, a sad accident; a sad misfortune.

7. Hence, bad; naughty; troublesome; wicked. Sad tipsy fellows, both of them.

Sad is sometimes used in the formation of self-explaining compounds; as, sad-coloured, sad-eyed, sad-hearted, sad-looking, and the like. Sad bread, heavy bread.

Synonym: Sorrowful, mournful, gloomy, dejected, depressed, cheerless, downcast, sedate, serious, grave, grievous, afflictive, calamitous.

Origin: OE. Sad sated, tired, satisfied, firm, steadfast, AS. Saed satisfied, sated; akin to D. Zat, OS. Sad, G. Tt, OHG. Sat, sar, saddr, Goth. Saps, Lith. Sotus, L. Sat, satis, enough, satur sated, Gr. To satiate enough. Cf. Assets, Sate, Satiate, Satisfy Satire.


Please contribute to this project, if you have more information about this term feel free to edit this page



Results from our forum


Re: Mutagenesis

??? No one knows .. OOps? :( :(

See entire post
by Shaanu
Sun May 11, 2014 11:01 am
 
Forum: Genetics
Topic: Mutagenesis
Replies: 2
Views: 640

Annealing Temparature

My Gene of Interest is 2kb long Primer-F : GCTCTAGAGTGATAGTAGGCATGG Primer-R : GCGATATCCTACACCCAAGCTGC I used the following program: 94C 1min 94C 2min 56C 1min 72C 2min final elongation 72C 7min I'm failed to amplify my gene of interest. please help me. :( :( :( :( :(

See entire post
by Helics
Tue Feb 18, 2014 10:49 am
 
Forum: Molecular Biology
Topic: Annealing Temparature
Replies: 4
Views: 1368

blank and substrate control give OD reads

Hi there...I'm new here. Hopefully all of u can solve my problem. I'm working on screening of xylanase variants to look for the better variant than the wild type in hydrolysis kenaf. the reaction is done in 96 deep well plate by adding substrate (kenaf) + buffer (50mM sodium acetate, pH 5.0) + enzym...

See entire post
by intandiana
Wed Jan 15, 2014 7:21 am
 
Forum: Molecular Biology
Topic: blank and substrate control give OD reads
Replies: 9
Views: 3156

Small Mammal's Lower Jaw? Very unique- trying to identify

... of mine shot that was hangin around the cattle station where we lived. This thing would come in and eat the left overs in the bin, it was a skinny sad looking specimen and when he retrieved the carcase it's tusks had grown around back through the jawbone twice! yes, amazing, the poor thing must ...

See entire post
by vk4vfx
Wed Nov 20, 2013 10:39 am
 
Forum: Zoology Discussion
Topic: Small Mammal's Lower Jaw? Very unique- trying to identify
Replies: 5
Views: 3344

Does the thylacine still live?

I loved to fool myself years back that they were still around and actually spent some time searching for them, weeks on end draggin a dead road kill roo around the dirt tracks at night in the 40 mile scrub all to no avail. Anyway as you are probably aware they also once inhabited the mainland also. ...

See entire post
by vk4vfx
Wed Nov 20, 2013 8:15 am
 
Forum: Zoology Discussion
Topic: Does the thylacine still live?
Replies: 4
Views: 2204
View all matching forum results

This page was last modified 21:16, 3 October 2005. This page has been accessed 3,431 times. 
What links here | Related changes | Permanent link