Dictionary » P » Primer

Primer

primer

short pre-existing polynucleotide chain towhich new deoxyribonucleotides can be added by dNA polymerase.


Please contribute to this project, if you have more information about this term feel free to edit this page



Results from our forum


Help: Confused with primers in a PCR of a vector?

... something I do not really understand. We used the pBS-gene as our template. We carried out four reactions, which are as followed: 1) T7 (forward primer); T3 (reverse primer) 2) T7 (forward primer); coding reverse (reverse primer) 3) T7 (forward primer); coding forward (reverse primer) 4) T3 (forward ...

See entire post
by keetner
Sat Mar 15, 2014 3:21 am
 
Forum: Molecular Biology
Topic: Help: Confused with primers in a PCR of a vector?
Replies: 0
Views: 65

Re: Annealing Temparature

Primer_F: 5'-GCTCTAGAGTGATAGTGAGCATGG-3' Primer_R: 5'-GCGATATCCTACACCCAAGCTGC-3' CORRECTED PRIMER SEQUENCE. THANKS ALL. I WILL TRY SUGGESTED EXP. CONDITION. THANKS "vladCH".

See entire post
by Helics
Sun Feb 23, 2014 4:59 pm
 
Forum: Molecular Biology
Topic: Annealing Temparature
Replies: 4
Views: 350

Annealing Temparature

My Gene of Interest is 2kb long Primer-F : GCTCTAGAGTGATAGTAGGCATGG Primer-R : GCGATATCCTACACCCAAGCTGC I used the following program: 94C 1min 94C 2min 56C 1min 72C 2min final elongation 72C 7min I'm failed to amplify my gene of interest. ...

See entire post
by Helics
Tue Feb 18, 2014 10:49 am
 
Forum: Molecular Biology
Topic: Annealing Temparature
Replies: 4
Views: 350

A question regarding PCR

... cacacacaca cacacacaca cacacacaca cacacacaca cacacacaca cacacacaca cacacacaca cacacattcg acggttgcag GCAAATACTG CCCTGTGGGG-3’ The places where primers should attach are written in capitals. My question is how many base pairs the amplified product will have, but it's not clear to me how to answer ...

See entire post
by x555
Sat Jan 18, 2014 11:05 am
 
Forum: Molecular Biology
Topic: A question regarding PCR
Replies: 1
Views: 454

Okazaki Fragment and RNA Primer

Hi, I have a simple semantics question. I have been reading some literature that seems to consider RNA Primers as part of Okazaki fragments, but this should not be so because Okazaki Fragments by definition are just the DNA portions synthesized on the lagging strand. Any opinions/clarifications on t...

See entire post
by ahyaa
Sun Nov 17, 2013 10:01 am
 
Forum: Molecular Biology
Topic: Okazaki Fragment and RNA Primer
Replies: 1
Views: 726
View all matching forum results

This page was last modified 21:16, 3 October 2005. This page has been accessed 22,516 times. 
What links here | Related changes | Permanent link