Dictionary » P » Portion

Portion

portion

1. That which is divided off or separated, as a part from a whole; a separated part of anything.

2. A part considered by itself, though not actually cut off or separated from the whole. These are parts of his ways; but how little a portion is heard of him! (job xxvi. 14) Portions and parcels of the dreadful past. (Tennyson)

3. A part assigned; allotment; share; fate. The lord of that servant . . . Will appoint him his portion with the unbelievers. (Luke xii. 46) Man's portion is to die and rise again. (Keble)

4. The part of an estate given to a child or heir, or descending to him by law, and distributed to him in the settlement of the estate; an inheritance. Give me the portion of goods that falleth to me. (Luke xv. 12)

5. A wife's fortune; a dowry.

Synonym: division, share, parcel, quantity, allotment, dividend.

Portion, part. Part is generic, having a simple reference to some whole. Portion has the additional idea of such a division as bears reference to an individual, or is allotted to some object; as, a portion of one's time; a portion of Scripture.

Origin: F, from L. Portio, akin to pars, partis, a part. See Part.

1. To separate or divide into portions or shares; to parcel; to distribute. And portion to his tribes the wide domain. (pope)

2. To endow with a portion or inheritance. Him portioned maids, apprenticed orphans, blest. (pope)

Origin: Portioned; Portioning.


Please contribute to this project, if you have more information about this term feel free to edit this page



Results from our forum


cellular mechanisms that result in symptoms of cholera

... bond. The five B subunits form a five-membered ring that binds to GM1 gangliosides on the surface of the intestinal epithelium cells. The A1 portion of the A subunit is an enzyme that ADP-ribosylates G proteins, while the A2 chain fits into the central pore of the B subunit ring. Upon binding, ...

See entire post
by adithya528
Tue Dec 11, 2012 1:49 pm
 
Forum: Cell Biology
Topic: cellular mechanisms that result in symptoms of cholera
Replies: 4
Views: 1067

Standards for Milk & Frozen Vegetables

I have a small project in microbiology and I am having trouble with a portion of it. I needed to find standards for raw, pasteurized & ultra pasteurized milk & frozen vegetables. Also, why do standards differ from milk vs. veggies. I believe I have ...

See entire post
by kclay
Fri Nov 23, 2012 8:19 pm
 
Forum: Microbiology
Topic: Standards for Milk & Frozen Vegetables
Replies: 0
Views: 315

How do I create the sequence contig of this DNA?

... Read 7: atttccattttaacaacaggagaaggagaaggaagagttggtattatcctgactttagccatgaa c. Use these 7 sequence reads to create a sequence contig of this portion of the H. sapiens cDNA. Show clearly how you achieved this. I don't understand what's going on, help me to understand what this DNA sequence ...

See entire post
by TToe
Tue Nov 20, 2012 1:41 pm
 
Forum: Genetics
Topic: How do I create the sequence contig of this DNA?
Replies: 2
Views: 414

What is qualitative trait loci?

... to infection in sorghum, the resistance response appears to be controlled by several quantitative trait loci (QTLs) that account for a significant portion of the resistance phenotype." What does qualitative trait loci mean?

See entire post
by Holmes
Mon Oct 08, 2012 2:53 pm
 
Forum: General Discussion
Topic: What is qualitative trait loci?
Replies: 1
Views: 465

Re: question for evolutionary biologist.

... in decoding a cell's genetic information. During transcription, Enzymes called RNA polymerases build RNA molecules that are complementary to a portion of one strand of the DNA double helix. Now what is an enzyme? Guess what? It is a protein. This basic refresher tell us that a Protein is required ...

See entire post
by scottie
Sat Aug 25, 2012 10:40 pm
 
Forum: Evolution
Topic: question for evolutionary biologist.
Replies: 26
Views: 13550
View all matching forum results

This page was last modified 21:16, 3 October 2005. This page has been accessed 8,965 times. 
What links here | Related changes | Permanent link