Answers to all your Biology Questions
|
|
Dictionary » P » Polymorphism PolymorphismDefinition noun (general) The ability to assume different forms or shapes. (biology) The occurrence of more than one kind or form of organisms of the same species that exist together in one locality. (chemistry) Crystallization of a compound in at least two distinct forms.
(biology) Polymorphism occurs when different phenotypes exist in the same population of a species. It is independent of sexual variations, and not connected by intermediate gradations but produced from common parents. The most common example of polymorphism is sexual dimorphism in most higher organisms.
Variant: morph Compare: pleomorphism. Related term: genetic polymorphism
Please contribute to this project, if you have more information about this term feel free to edit this page
Results from our forumRe: Muscular dystrophy inheritance question... is heterozygous (at least over the sequence given in the lower traces). The female might have a splice site mutation, as the sequence across the polymorphism is either ATGTGAAG or ATGGGAAG and a GT, present in only one allele, is the canonical start of an intron sequence (other factors such as ...
See entire post
Re: Muscular dystrophy inheritance question... female has two copies of the dystrophin gene that differ slightly, this can give rise to the two traces in the sequence (it's a single-nucleotide polymorphism). This suggests the female may be a carrier with a DMD allele and a wild-type allele for dystrophin, but the pedigree makes it look like ...
See entire post
Re: Muscular dystrophy inheritance question... female has two copies of the dystrophin gene that differ slightly, this can give rise to the two traces in the sequence (it's a single-nucleotide polymorphism). This suggests the female may be a carrier with a DMD allele and a wild-type allele for dystrophin, but the pedigree makes it look like ...
See entire post
Population Genetics Questions... 4: AATAACAACATTTTTGTTTTTAAGA Sequence 5: TGTTATTTTTATTTCAGATGCGA Sequence 6: TTCAGATGCGATCTGTGAGCCGAG Four maize populations are genotyped for a polymorphism in the R gene, which has two alleles, R1 and R2. The frequencies of each of the possible three genotypes are shown in the following table: ...
See entire post
Book recommendation for exam... and life history of Paramaecium, Monocystis, Plasmodium, and Leishmania. 4. Porifera : Skeleton, canal system and reproduction. 5. Coelenterata : Polymorphism, defensive structures and their mechanism; coral reefs and their formation; metagenesis; general features and life history of Obelia and ...
See entire post
This page was last modified 00:08, 6 December 2008. This page has been accessed 5,322 times. |
© Biology-Online.org. All Rights Reserved.
Register | Login
| About Us | Contact Us | Link to Us | Disclaimer & Privacy