Peptide

... you dilute your system with water and take the enzyme exactly when your eating your food, the enzyme may work, otherwise your just making little peptide bonds that will be useless.

See entire post

... break lactose to glucose and galactose Protein Enzymes Pepsin (secreted as pepsinogen) - made in gastric glands, functions in the stomach to break peptide bonds Trypsin (secreted as trypsinogen) - made in pancreas, functions in the small intestine to break specific peptide bonds and converts chymotrypsinogen ...

See entire post

... well, but there was one on there that whacked me between the eyes, here it is... 15.The following DNA sequence shows a gene encoding a small peptide. The promoter region is given in brackets. The three stop codons are UAA, UAG and UGA. 5' (ATGACGTATAA)TGACCGTACATGAGTAATACATAAATCAG 3' 3' (TACTGCATATT)ACTGGCATGTACTCATTATGTATTTAGTC ...

See entire post

... more cell-cell interactions and use of co-receptors. Thus, the adaptive response is slower, but very specific, recognizing mostly protein or peptide motifs. Thus, the type of immune response is largely determined by the type of the recognized molecule, as well as time; unless there is immunological ...

See entire post

... the cells do not divide actively, but when they have reached the so-called naive stage (CD45RA+) they divide if they encounter a specific peptide:MHC for their T cell receptor. Unless the TCR signal is very strong (may cause anergy or apoptosis) or very weak (causes no activation) the ...

See entire post