Dictionary » M » Maize



(Science: botany) a large species of American grass of the genus zea (Z. Mays), widely cultivated as a forage and food plant; indian corn. Also, its seed, growing on cobs, and used as food for men animals.

(Science: zoology) maize eater, a south American bird of the genus Pseudoleistes, allied to the troupials. Maize yellow, a delicate pale yellow.

Origin: sp. Maiz. Fr. Mahiz or mahis, i the language of the island of Hayti.

Please contribute to this project, if you have more information about this term feel free to edit this page

Results from our forum

Data analysis: DNA alignment HELP?

... to determine whether plants also possessed CDKs that functioned as the catalysts for cell cycle progression. To isolate a cDNA encoding a CDK in maize, investigators aligned the predicted amino acid sequences of human cdc2, S. pombe cdc2, and S. cerevisiae cdc28 genes. Degenerate oligonucleotide ...

See entire post
by TToe
Mon Feb 18, 2013 10:40 am
Forum: Genetics
Topic: Data analysis: DNA alignment HELP?
Replies: 1
Views: 1902

Population Genetics Questions

... 3: ATGCGATCTGTGAGCCGAGTCTTTA Sequence 4: AATAACAACATTTTTGTTTTTAAGA Sequence 5: TGTTATTTTTATTTCAGATGCGA Sequence 6: TTCAGATGCGATCTGTGAGCCGAG Four maize populations are genotyped for a polymorphism in the R gene, which has two alleles, R1 and R2. The frequencies of each of the possible three genotypes ...

See entire post
by animus31
Wed Nov 21, 2012 3:36 pm
Forum: Genetics
Topic: Population Genetics Questions
Replies: 3
Views: 2490


but what if we take plants of same magnitude?? will in this condition maize release more oxygen then any other C3 plants???

See entire post
Wed Feb 08, 2012 1:38 pm
Forum: Botany Discussion
Topic: botany
Replies: 8
Views: 2512


simply because tree weight some order of magnitude more than maize thus it had to produce more oxygen.

See entire post
by JackBean
Wed Feb 08, 2012 9:43 am
Forum: Botany Discussion
Topic: botany
Replies: 8
Views: 2512


Fully grown tree has produced more oxygen than maize. Is that OK? :roll: You have to compare it per something. Like per gram of assimilated carbon or per day (hour, year, whatever), etc.

See entire post
by JackBean
Wed Feb 08, 2012 8:06 am
Forum: Botany Discussion
Topic: botany
Replies: 8
Views: 2512
View all matching forum results

This page was last modified 21:16, 3 October 2005. This page has been accessed 4,791 times. 
What links here | Related changes | Permanent link