Dictionary » L » Link

Link

Link

to connect or unite with a link or as with a link; to join; to attach; to unite; to couple. All the tribes and nations that composed it [the roman Empire] were linked together, not only by the same laws and the same government, but by all the facilities of commodious intercourse, and of frequent communication. (Eustace)

Origin: Linked; Linking.

1. A single ring or division of a chain.

2. Hence: Anything, whether material or not, which binds together, or connects, separate things; a part of a connected series; a tie; a bond. Links of iron. . The link of brotherhood, by which One common Maker bound me to the kind. (Cowper) And so by double links enchained themselves in lovers life. (Gascoigne)

3. Anything doubled and closed like a link; as, a link of horsehair.

4. (Science: physics) Any one of the several elementary pieces of a mechanism, as the fixed frame, or a rod, wheel, mass of confined liquid, etc, by which relative motion of other parts is produced and constrained.

5. (Science: medicine) The slotted bar, or connecting piece, to the opposite ends of which the eccentric rods are jointed, and by means of which the movement of the valve is varied, in a link motion.

6. The length of one joint of Gunter's chain, being the hundredth part of it, or 7.92 inches, the chain being 66 feet in length. Cf. Chain.

7. (Science: chemistry) a bond of affinity, or a unit of valence between atoms; applied to a unit of chemical force or attraction.

8. Sausages; because linked together.

Origin: oe. Linke, as. Hlence; akin to Sw. Lank ring of a chain, dan. Laenke chain, Icel. Hlekkr; cf. G. Gelenk joint, link, ring of a chain, lenken to bend.


Please contribute to this project, if you have more information about this term feel free to edit this page



Results from our forum


why do dogs have bigger brain than cats

DO dogs have proportionately bigger brains? Maybe... There are a couple of possible explanations, including the semi-literate one in your link. Sociality does seem to require some extra brain power. Another possibility may be linked to smaller dogs being bred from originally larger dogs - every ...

See entire post
by Darby
Sun Mar 22, 2015 7:25 pm
 
Forum: Zoology Discussion
Topic: why do dogs have bigger brain than cats
Replies: 2
Views: 463

why do dogs have bigger brain than cats

About this question, I have searched some materials and found this blog interesting and might have explained the question. Do you think so? The link of the post is http://www.scienceplease.com/events/do-you-know-why-dogs-have-bigger-brian-cats

See entire post
by biomart
Fri Mar 20, 2015 2:04 am
 
Forum: Zoology Discussion
Topic: why do dogs have bigger brain than cats
Replies: 2
Views: 463

genotype ratio and phenotype ratio in X linked allege

Ok I how would I write out the genotype and phenotype for a X link recessive gene when after the punnett square the two females are not effect and the two males are effected?

See entire post
by greenchicken
Wed Mar 18, 2015 8:57 pm
 
Forum: Genetics
Topic: genotype ratio and phenotype ratio in X linked allege
Replies: 0
Views: 142

How to read this tricky electropherogram?

... lane (3) GAACAGTACCCCGACTGGCCAGCCGAGACATGTTGACCATCCCACCCCATGCGAGCTCATCAAGGAAAGACTAAGTCAGAGAGTCCTCTCTGAC Image link https://mysowar.files.wordpress.com/2015/02/img.jpg

See entire post
by kabtq9s
Sat Feb 21, 2015 3:23 am
 
Forum: Molecular Biology
Topic: How to read this tricky electropherogram?
Replies: 1
Views: 575

Re: Bio Research Paper Writing

... form and style required for the Journal of Biological Chemistry, requirements that are shared by many journals in the life sciences. Check this link hope it will help you. http://www.ruf.rice.edu/~bioslabs/tools/report/reportform.html

See entire post
by BrentElmer
Fri Jan 30, 2015 7:15 am
 
Forum: General Discussion
Topic: Bio Research Paper Writing
Replies: 3
Views: 18749
View all matching forum results

This page was last modified 21:16, 3 October 2005. This page has been accessed 3,352 times. 
What links here | Related changes | Permanent link