Dictionary » L » Lane

Lane

Lane

a passageway between fences or hedges which is not traveled as a highroad; an alley between buildings; a narrow way among trees, rcks, and other natural obstructions; hence, in a general sense, a narrow passageway; as, a lane between lines of men, or through a field of ice. It is become a turn-again lane unto them which they can not go through. (Tyndale)

Origin: oe. Lane, lone, as. Lone, lone; akin to D. Laan, OFries. Lana, lona.


Please contribute to this project, if you have more information about this term feel free to edit this page



Results from our forum


How to read this tricky electropherogram?

... them in Blast... nothing came up. All what I know is that this is a human gene. Any ideas? Here are the three sequences and the actual graph lane (1) AAAGTGCATCTCCTCCGACATTGGAGGATCCCAAGCTCTCATGTTGCCCTTATTGTCACCAGTGACATTTATTCCAAACAGGAGTCCTTCGGGCCAGCAAA lane (2) GCTGCCCAGGCTTAGCTGCGAGCCCGTCATGGAGAAAAAGCTCAGAGAAAAGCAGTCTGTTGGAGAATGGGACAGTCACCAGAGACACCTCGTGGGGCTCAGCGGTTCT ...

See entire post
by kabtq9s
Sat Feb 21, 2015 3:23 am
 
Forum: Molecular Biology
Topic: How to read this tricky electropherogram?
Replies: 1
Views: 521

separation problem with GelRed

... loaded DNA. Overloading of DNA often results in band smearing. The recommended amount for ladders and samples of known concentration is 50-200 ng/lane. If the concentration is unknown, try loading one half or one third of the usual amount of DNA. 2. Reduce the amount of GelRed. Try using 0.5X ...

See entire post
by Biotium
Wed Nov 26, 2014 4:43 pm
 
Forum: Molecular Biology
Topic: separation problem with GelRed
Replies: 12
Views: 19576

Gel electrophoresis

Hey guys! Would anyone know, in each of the Lane 2's, why there is a very large bright fragment that doesn't really confine to the shape of a rectangle? Just a general description would be helpful. Thank you!

See entire post
by downingrock
Wed Mar 12, 2014 12:44 pm
 
Forum: Genetics
Topic: Gel electrophoresis
Replies: 3
Views: 2898

Weird - shaped band on western blotting

... to see the cell cycle regulation protein. Recently I got a weird-shaped band on my western blot. It is like an upside-down of smiling face in each lane. I use the same loading buffer, electrophoresis buffer, lysis buffer, and also the same 1st and 2nd antibody for this experiment. I also try to ...

See entire post
by namakulaila
Thu Oct 17, 2013 6:17 am
 
Forum: Molecular Biology
Topic: Weird - shaped band on western blotting
Replies: 2
Views: 2447

SDS-PAGE gel and Rf values

Hello, I have to calculate the Rf for the molecular weight markers in lane one of the gel that I attached. When I do this and graph the Rf values against the molecular weight my graph is not linear. I marked in red where I am measuring from. Can someone please ...

See entire post
by cschauss
Sun Mar 03, 2013 7:37 am
 
Forum: Cell Biology
Topic: SDS-PAGE gel and Rf values
Replies: 2
Views: 3360
View all matching forum results

This page was last modified 21:16, 3 October 2005. This page has been accessed 2,363 times. 
What links here | Related changes | Permanent link