Home Forum Dictionary Articles Tutorials Books Directory Share your work


Edit page | Page history | Printable version

Dictionary » J » Junction

Junction

Junction

1. The act of joining, or the state of being joined; union; combination; coalition; as, the junction of two armies or detachments; the junction of paths.

2. The place or point of union, meeting, or junction; specifically, the place where two or more lines of railway meet or cross. Junction plate, the switch, or movable, rails, connecting one line of track with another.

Origin: L. Junctio, fr. Jungere, junctum, to join: cf. F. Jonction. See join.


Please contribute to this project, if you have more information about this term feel free to edit this page



Results from our forum


plasmodesm and gap junction

... plasmodesmata but animal cells haven't any barrier like cell walls for protein transportation. So an animal cell necessarily doesn't have gap junction. But I'm not sure. Is it right? Any idea would be appreciated.

See entire post
by mnatashgaran
Mon Apr 01, 2013 7:46 pm
 
Forum: Cell Biology
Topic: plasmodesm and gap junction
Replies: 1
Views: 545

plasmodesm and gap junction

Both of plasmodesm (in plant cells) and gap juction (in animal cells) pass the micromolecules & ions and connect the cells to each other. Why do all plant cells have plasmodesmata but only some animal cells have gap junctions?

See entire post
by mnatashgaran
Sun Mar 31, 2013 7:42 pm
 
Forum: Cell Biology
Topic: plasmodesm and gap junction
Replies: 1
Views: 545

Re: connexins & pannexins

In this review, we briefly summarize what is known about the properties of the three families of gap junction proteins, connexins, innexins and pannexins, emphasizing their importance as intercellular channels that provide ionic and metabolic coupling and as non-junctional ...

See entire post
by brad000123
Sat Oct 20, 2012 11:54 am
 
Forum: Molecular Biology
Topic: connexins & pannexins
Replies: 6
Views: 4428

Real Time reverse transcription PCR Questions

... 5' CCTCCATGAGATCCATATGGAG 3'? I’ve read that you want the primers to be within an exon and also that you want the primers to be at an exon-exon junction because that would eliminate genomic DNA contamination. Which one is correct and why? I think I understand the concept behind adding restriction ...

See entire post
by wessH
Sun Jun 03, 2012 2:21 pm
 
Forum: Molecular Biology
Topic: Real Time reverse transcription PCR Questions
Replies: 0
Views: 1490

Re:

... determines what can and can't penetrate. If you are unfamilliar with the following terms it might help to look them up. Dermis, Epidermis, tight junction, keratin, keratinocyte. I know what the terms mean. I have a friend that tells me that fabric softener and such can and do cause cancer because ...

See entire post
by LadyGuinevere
Thu May 26, 2011 5:49 pm
 
Forum: General Discussion
Topic: Skin Absorption information please
Replies: 3
Views: 2314
View all matching forum results

This page was last modified 21:16, 3 October 2005. This page has been accessed 5,118 times. 
What links here | Related changes | Permanent link