Dictionary » I » Informational RNA

Informational RNA

Definition

noun

A type of RNA that carries the code or chemical blueprint for a specific protein. In the early stages of protein synthesis, the mRNA is synthesized from a DNA template during transcription.


Supplement

The informational RNA or messenger RNA (mRNA) is one of the three types of RNA; the other two are transfer RNA (tRNA) and ribosomal RNA (rRNA).

In eukaryotes, the mRNA carries the genetic information from the nucleus to the site of protein synthesis (ribosome) in the cytoplasm to be translated. In non-eukaryotes such as bacteria, the mRNA is produced and translated in the cytoplasm of the bacterial cell.


Synonyms:


Please contribute to this project, if you have more information about this term feel free to edit this page



Results from our forum


Re: The general theory of origin of life

... for the transformation of matter from nonliving to the living (DNA or RNA). That's not how the theory of creationism works. Anything we can make ... and distribution. Proposed model does not contradict to teleonomical (informational) creationism - a Plan (Design) and Purpose, and reveals the ...

See entire post
by leniel
Thu Feb 07, 2013 10:15 pm
 
Forum: General Discussion
Topic: The general theory of origin of life
Replies: 13
Views: 13873

DNA Transcription

... that is found throughout your body: AAGATTAGTAGTACGACAATC Is this the informational or template sequence? How could you tell? What does your conclusion ... that decoded to give you this answer? And Question 2 is: This is an mRNA sequence for the name of a protein found throughout your body: 5' ...

See entire post
by randylo
Thu May 15, 2008 3:32 pm
 
Forum: Molecular Biology
Topic: DNA Transcription
Replies: 4
Views: 5775

Basic Bio Questions

... molecules is believed to have been the first "hereditary"(informational) molecule? a. DNA b. RNA c. protein d. ATP 2. The earliest life forms on the planet are thought to have resembled? ...

See entire post
by edbaseball17
Tue Sep 18, 2007 10:24 pm
 
Forum: General Discussion
Topic: Basic Bio Questions
Replies: 6
Views: 6195

The Fiber Disease

... information, operating on a continuum of genetic molecules (DNA, RNA, proteins, etc). Here, previously unknown types of memory (soliton, holographic, ... in transitional states of consciousness) making the giant cosmic informational network with delocallized con- sciousness, implying the crucial ...

See entire post
by Nadas Moksha
Mon Dec 11, 2006 1:03 am
 
Forum: Human Biology
Topic: The Fiber Disease
Replies: 7403
Views: 5487659

The Fiber Disease

Oh, and.. not for those hat know it all... . .. DNA is the informational basis from which living cells derive instructions for synthesizing ... into a complementary, single strand of nucleotides known as messenger RNA, or mRNA. The mRNA provides the instructions by which other components in ...

See entire post
by Nadas Moksha
Mon Nov 06, 2006 7:01 am
 
Forum: Human Biology
Topic: The Fiber Disease
Replies: 7403
Views: 5487659


This page was last modified 13:38, 17 August 2009. This page has been accessed 1,477 times. 
What links here | Related changes | Permanent link