Home Forum Dictionary Articles Tutorials Books Directory Share your work


Edit page | Page history | Printable version

Dictionary » I » Informational RNA

Informational RNA

Definition

noun

A type of RNA that carries the code or chemical blueprint for a specific protein. In the early stages of protein synthesis, the mRNA is synthesized from a DNA template during transcription.


Supplement

The informational RNA or messenger RNA (mRNA) is one of the three types of RNA; the other two are transfer RNA (tRNA) and ribosomal RNA (rRNA).

In eukaryotes, the mRNA carries the genetic information from the nucleus to the site of protein synthesis (ribosome) in the cytoplasm to be translated. In non-eukaryotes such as bacteria, the mRNA is produced and translated in the cytoplasm of the bacterial cell.


Synonyms:


Please contribute to this project, if you have more information about this term feel free to edit this page



Results from our forum


Re: Help with sequencing DNA.

... is the mRNA, then the sense/coding DNA is the same, but the U's are T's in DNA: 5' A A G G G T G T A G A A G C T A A G G G T 3' the anti-sense/informational DNA is the opposite: 3' T T C C C A C A T C T T C G A T T C C C A 5' but most times it is written in the 5' to 3': 5' A C C C T T A G ...

See entire post
by kolean
Sat Jun 27, 2009 1:37 pm
 
Forum: Molecular Biology
Topic: Help with sequencing DNA.
Replies: 3
Views: 189

Help with sequencing DNA.

Alright, I am struggling to find the informational DNA sequence and anti-sense DNA sequence to the resulting informational DNA sequence for the following mRNA sequence: 5' A AG G G U G U A G A A G C U A A G G G U 3' I contrived the following ...

See entire post
by Melany87
Sat Jun 27, 2009 2:39 am
 
Forum: Molecular Biology
Topic: Help with sequencing DNA.
Replies: 3
Views: 189

Stomach bloating and weight gain

... give your body time to cleanse out what it is holding onto - the toxic stuff. anyways, there is so much support and forums to ask questions, and informational videos and blogs and postings. one of the best things i have ever read. hope this helps, Jess baxter baxterbutt8873@msn.com

See entire post
by baxterbutt8873
Sun Apr 19, 2009 11:04 pm
 
Forum: Physiology
Topic: Stomach bloating and weight gain
Replies: 299
Views: 484504

DNA Transcription

... that is found throughout your body: AAGATTAGTAGTACGACAATC Is this the informational or template sequence? How could you tell? What does your conclusion ... that decoded to give you this answer? And Question 2 is: This is an mRNA sequence for the name of a protein found throughout your body: 5' ...

See entire post
by randylo
Thu May 15, 2008 3:32 pm
 
Forum: Molecular Biology
Topic: DNA Transcription
Replies: 4
Views: 1520

Mg/Ca advice

a relationship between magnesium and calcium? Kind of a strange question. Generally calcium is used by cells as a second messenger, with an informational role. Magnesium, on the other hand, is generally used as a cofactor for some enzymes.

See entire post
by MrMistery
Sun May 04, 2008 5:44 pm
 
Forum: Human Biology
Topic: Mg/Ca advice
Replies: 4
Views: 1106
View all matching forum results

This page was last modified 13:38, 17 August 2009. This page has been accessed 3 times. 
What links here | Related changes | Permanent link