Dictionary » I » Ideas

Ideas

Idea

Any mental image or concept.

Origin: g. Semblance


Please contribute to this project, if you have more information about this term feel free to edit this page



Results from our forum


amplification in no RT control

... I am not getting dimers and my reagents are 'good' I have tried cDNA at 10ng and 5ng and primer conc. at both 200uM and 400uM. I'm kind of out of ideas now...more/longer DNase digestion? Or does this sound more like an optimisation issue? Thanks in advance for your input.

See entire post
by biomart
Fri Mar 20, 2015 1:58 am
 
Forum: General Discussion
Topic: amplification in no RT control
Replies: 1
Views: 148

gene knockout mice

... Cre recombinase–mediated knockout of XX gene knockout mice? Any one understand how to make the knockout locate in striatum?or any other good ideas to knockout one gene in one special cell from one specia area?

See entire post
by w19910411
Wed Mar 18, 2015 6:22 am
 
Forum: Genetics
Topic: gene knockout mice
Replies: 1
Views: 459

How to read this tricky electropherogram?

... to the best of my ability of ~100 bp segments and searched them in Blast... nothing came up. All what I know is that this is a human gene. Any ideas? Here are the three sequences and the actual graph lane (1) AAAGTGCATCTCCTCCGACATTGGAGGATCCCAAGCTCTCATGTTGCCCTTATTGTCACCAGTGACATTTATTCCAAACAGGAGTCCTTCGGGCCAGCAAA ...

See entire post
by kabtq9s
Sat Feb 21, 2015 3:23 am
 
Forum: Molecular Biology
Topic: How to read this tricky electropherogram?
Replies: 1
Views: 556

Beginner Microbiologist, looking for a place to start.

... in Agar plates. I am at a point where I want to start doing experiments or research that contribute to science in some way. Does anyone have any ideas? I just need something to do to keep me interested in microbiology. thank you.

See entire post
by fstevens
Sat Dec 13, 2014 3:30 pm
 
Forum: General Discussion
Topic: Beginner Microbiologist, looking for a place to start.
Replies: 1
Views: 1138

Are predators always smarter than their prey?

The difficulty with the concept of innate ideas or innate behaviors is that it is difficult to prove every potential environmental factor did not cause the observed behavior. For example, showing that chicks react to bird-like shapes above them ...

See entire post
by BasicBiology
Tue Nov 04, 2014 5:09 am
 
Forum: Zoology Discussion
Topic: Are predators always smarter than their prey?
Replies: 15
Views: 15957
View all matching forum results

This page was last modified 21:16, 3 October 2005. This page has been accessed 3,954 times. 
What links here | Related changes | Permanent link