Dictionary » H » Human being

Human being

Definition

noun, plural: human beings

A bipedal primate belonging to the genus Homo, especially Homo sapiens.


Supplement

In taxonomy, human beings belong to the family Hominidae, of the Primates, under class Mammalia of phylum Chordata.


Word origin: human, from Latin hūmānus, of homō meaning "man"

Related form(s): humane (adjective), humanity (noun)

See also:


Please contribute to this project, if you have more information about this term feel free to edit this page



Results from our forum


Re: human brain size

Since around 30.000 years ago the human brain used to be bigger in size (with Homo neanderthalensis having the biggest brain size. Since then the average brain size has been a shrinking over the past 28,000 years), a friend of mine claims ...

See entire post
by Semisane
Tue Mar 03, 2015 9:51 am
 
Forum: Evolution
Topic: human brain size
Replies: 1
Views: 511

Re:

MRI scan of human brains have shown that the brains of different races are of different sizes. The Worldwide Pattern of IQ Scores. East Asians average higher on IQ tests than Whites, both in the U. S. and in Asia, even though IQ ...

See entire post
by Seth90210
Wed Feb 25, 2015 2:37 am
 
Forum: Human Biology
Topic: Brain size=IQ level theory (Blacks vs Whites & Asians)
Replies: 75
Views: 332832

How to read this tricky electropherogram?

... on the graph to the best of my ability of ~100 bp segments and searched them in Blast... nothing came up. All what I know is that this is a human gene. Any ideas? Here are the three sequences and the actual graph lane (1) AAAGTGCATCTCCTCCGACATTGGAGGATCCCAAGCTCTCATGTTGCCCTTATTGTCACCAGTGACATTTATTCCAAACAGGAGTCCTTCGGGCCAGCAAA ...

See entire post
by kabtq9s
Sat Feb 21, 2015 3:23 am
 
Forum: Molecular Biology
Topic: How to read this tricky electropherogram?
Replies: 1
Views: 525

Re: Am I the Next Step in Human Evolution?

... and i ask those exact questions but everyone just laughs and says: no son you're just bla bla bla. i do believe we are possibly the next step in human evolution.

See entire post
by NumnumGaming
Thu Feb 19, 2015 7:11 pm
 
Forum: Evolution
Topic: Am I the Next Step in Human Evolution?
Replies: 25
Views: 45097

human brain size

Since around 30.000 years ago the human brain used to be bigger in size (with Homo neanderthalensis having the biggest brain size. Since then the average brain size has been a shrinking over the past 28,000 years), a friend of mine claims ...

See entire post
by Livinus
Thu Feb 19, 2015 6:01 pm
 
Forum: Evolution
Topic: human brain size
Replies: 1
Views: 511
View all matching forum results

This page was last modified 10:08, 5 October 2010. This page has been accessed 1,232 times. 
What links here | Related changes | Permanent link