Dictionary » H » Human

Human

Definition

noun, plural: humans

A bipedal primate belonging to the genus Homo, especially Homo sapiens.


adjective

Of, pertaining to, having the attributes of, a being belonging to the species of the Homo sapiens.


Supplement

In taxonomy, humans belong to the family Hominidae, of the Primates, under class Mammalia of phylum Chordata. They are identified by the highly developed brain that confers advanced skills in abstract reasoning, articulate language, self-awareness, problem solving, and sapience. They are bipedal primates in having an erect carriage. They are skillful in handling objects with their hands.

Humans may also be described as social animals capable of showing sympathy with other beings, and living life with (inherent) values and ethics.


Word origin: from Latin hūmānus, of homō meaning "man"

Related form(s): humane (adjective), humanity (noun)

See also:

Related term(s):

Mentioned in:


Please contribute to this project, if you have more information about this term feel free to edit this page



Results from our forum


Re: human brain size

Since around 30.000 years ago the human brain used to be bigger in size (with Homo neanderthalensis having the biggest brain size. Since then the average brain size has been a shrinking over the past 28,000 years), a friend of mine claims ...

See entire post
by Semisane
Tue Mar 03, 2015 9:51 am
 
Forum: Evolution
Topic: human brain size
Replies: 1
Views: 502

Re:

MRI scan of human brains have shown that the brains of different races are of different sizes. The Worldwide Pattern of IQ Scores. East Asians average higher on IQ tests than Whites, both in the U. S. and in Asia, even though IQ ...

See entire post
by Seth90210
Wed Feb 25, 2015 2:37 am
 
Forum: Human Biology
Topic: Brain size=IQ level theory (Blacks vs Whites & Asians)
Replies: 75
Views: 332638

How to read this tricky electropherogram?

... on the graph to the best of my ability of ~100 bp segments and searched them in Blast... nothing came up. All what I know is that this is a human gene. Any ideas? Here are the three sequences and the actual graph lane (1) AAAGTGCATCTCCTCCGACATTGGAGGATCCCAAGCTCTCATGTTGCCCTTATTGTCACCAGTGACATTTATTCCAAACAGGAGTCCTTCGGGCCAGCAAA ...

See entire post
by kabtq9s
Sat Feb 21, 2015 3:23 am
 
Forum: Molecular Biology
Topic: How to read this tricky electropherogram?
Replies: 1
Views: 515

Re: Am I the Next Step in Human Evolution?

... and i ask those exact questions but everyone just laughs and says: no son you're just bla bla bla. i do believe we are possibly the next step in human evolution.

See entire post
by NumnumGaming
Thu Feb 19, 2015 7:11 pm
 
Forum: Evolution
Topic: Am I the Next Step in Human Evolution?
Replies: 25
Views: 45023

human brain size

Since around 30.000 years ago the human brain used to be bigger in size (with Homo neanderthalensis having the biggest brain size. Since then the average brain size has been a shrinking over the past 28,000 years), a friend of mine claims ...

See entire post
by Livinus
Thu Feb 19, 2015 6:01 pm
 
Forum: Evolution
Topic: human brain size
Replies: 1
Views: 502
View all matching forum results

This page was last modified 14:00, 13 September 2010. This page has been accessed 30,498 times. 
What links here | Related changes | Permanent link