
|
|
Dictionary » H » Homo sapiens sapiens Homo sapiens sapiensDefinition noun A subspecies of Homo sapiens where modern human beings belong and the only extant species of the Homo genus.
Some of the early modern human remains found are the Cro-Magnon in Europe, Omo in south-western Ethiopia, and Skchul/Qafzeh hominids in Israel. These specimens are regarded as early modern humans because they still have some archaic features, such as prominent brow ridges and projecting face.
Abbreviation: H. s. sapiens Also called: See also: ![]()
Please contribute to this project, if you have more information about this term feel free to edit this page ![]()
Results from our forumHow long have humans been taxonomically considered apes?... the great apes etc. The classifications shift around but how long have homo sapiens been considered taxonomically to be apes? And is there any controversy within taxonomy ...
See entire post
How long have humans been taxonomically considered apes?... the great apes etc. The classifications shift around but how long have homo sapiens been considered taxonomically to be apes? And is there any controversy within taxonomy ...
See entire post
Glutamine synthetase in animals... marks) and any animal whose genome has been sequenced, e.g. "Homo sapiens", "Caenorhabditis elegans".
See entire post
How do I create the sequence contig of this DNA?... have the following sequence reads from the protein-encoding region of a Homo sapiens cDNA clone: Read 1: tattatcctgactttagccatgaatatcatgagtacattgcagtgggctgttaactccagcataga ...
See entire post
Re: Green mammals... example of 'green mammals' that is oddly overlooked is our own species, homo sapiens. It is not uncommon for southern Europeans, Middle Easterners, or North Africans to ...
See entire post
This page was last modified 09:52, 5 October 2010. This page has been accessed 2,905 times. |
© Biology-Online.org. All Rights Reserved.
Register | Login
| About Us | Contact Us | Link to Us | Disclaimer & Privacy