Dictionary » H » Homo sapiens sapiens

Homo sapiens sapiens

Definition

noun

A subspecies of Homo sapiens where modern human beings belong and the only extant species of the Homo genus.


Supplement

Some of the early modern human remains found are the Cro-Magnon in Europe, Omo in south-western Ethiopia, and Skchul/Qafzeh hominids in Israel. These specimens are regarded as early modern humans because they still have some archaic features, such as prominent brow ridges and projecting face.


Word origin: Latin homo (human being, man) + sapiens (wise, sensible, judicious)

Abbreviation: H. s. sapiens

Also called:

See also:


Please contribute to this project, if you have more information about this term feel free to edit this page



Results from our forum


How long have humans been taxonomically considered apes?

... the great apes etc. The classifications shift around but how long have homo sapiens been considered taxonomically to be apes? And is there any controversy within taxonomy ...

See entire post
by Machy1
Fri Feb 08, 2013 1:08 am
 
Forum: General Discussion
Topic: How long have humans been taxonomically considered apes?
Replies: 0
Views: 140

How long have humans been taxonomically considered apes?

... the great apes etc. The classifications shift around but how long have homo sapiens been considered taxonomically to be apes? And is there any controversy within taxonomy ...

See entire post
by Machy1
Wed Feb 06, 2013 10:53 pm
 
Forum: Evolution
Topic: How long have humans been taxonomically considered apes?
Replies: 0
Views: 148

Glutamine synthetase in animals

... marks) and any animal whose genome has been sequenced, e.g. "Homo sapiens", "Caenorhabditis elegans".

See entire post
by wbla3335
Sat Jan 12, 2013 2:15 pm
 
Forum: Molecular Biology
Topic: Glutamine synthetase in animals
Replies: 2
Views: 367

How do I create the sequence contig of this DNA?

... have the following sequence reads from the protein-encoding region of a Homo sapiens cDNA clone: Read 1: tattatcctgactttagccatgaatatcatgagtacattgcagtgggctgttaactccagcataga ...

See entire post
by TToe
Tue Nov 20, 2012 1:41 pm
 
Forum: Genetics
Topic: How do I create the sequence contig of this DNA?
Replies: 2
Views: 414

Re: Green mammals

... example of 'green mammals' that is oddly overlooked is our own species, homo sapiens. It is not uncommon for southern Europeans, Middle Easterners, or North Africans to ...

See entire post
by biotag
Sat Sep 15, 2012 6:45 pm
 
Forum: Zoology Discussion
Topic: Green mammals
Replies: 11
Views: 6069
View all matching forum results

This page was last modified 09:52, 5 October 2010. This page has been accessed 2,905 times. 
What links here | Related changes | Permanent link