Homo

Hominidae and the great apes etc. The classifications shift around but how long have homo sapiens been considered taxonomically to be apes? And is there any controversy within taxonomy circles over this or is it universally accepted (within this field, not religiously ...

See entire post

Hominidae and the great apes etc. The classifications shift around but how long have homo sapiens been considered taxonomically to be apes? And is there any controversy within taxonomy circles over this or is it universally accepted (within this field, not religiously ...

See entire post

... Enter "glutamine synthetase" (with the quotation marks) and any animal whose genome has been sequenced, e.g. "Homo sapiens", "Caenorhabditis elegans".

See entire post

... DNA alignment of two genes: http://www.ebi.ac.uk/Tools/services/rest/emboss_needle/result/emboss_needle-I20121203-233912-0692-97003408-pg/aln The Homo Sapien is the longest DNA sequence. If the Homo Sapien gene has 1770 bases surely the overall aligned length should also be 1770, so why is it ...

See entire post

You have the following sequence reads from the protein-encoding region of a Homo sapiens cDNA clone: Read 1: tattatcctgactttagccatgaatatcatgagtacattgcagtgggctgttaactccagcataga Read 2: caaccaaaccatacaagaatggccaactctcgaaagttatgattattgagaattcacacgtg Read 3: agttatgattattgagaattcacacgtgaagaaagatgacatctggccctcagggggtcaaa ...

See entire post