Dictionary » G » Genbank



a database of nucleic acid and protein sequences at the national library of medicine in the united states of America, compiled from international sources. It has sequence data in 13 different categories: primate, mammal, rodent, vertebrate, invertebrate, organelle, rna, bacteria, plant, virus, bacteriophage, synthetic, and other. It is similar to the european molecular biology lab gene bank in Germany.

WWW: Genebank

Please contribute to this project, if you have more information about this term feel free to edit this page

Results from our forum

Glutamine synthetase in animals

Yes. Check out GenBank http://www.ncbi.nlm.nih.gov/nuccore. Enter "glutamine synthetase" (with the quotation marks) and any animal whose genome has been sequenced, e.g. "Homo sapiens", "Caenorhabditis elegans".

See entire post
by wbla3335
Sat Jan 12, 2013 2:15 pm
Forum: Molecular Biology
Topic: Glutamine synthetase in animals
Replies: 2
Views: 1243

Re: question for evolutionary biologist.

... this paper from Venter's team helpful. http://www.ncbi.nlm.nih.gov/nuccore/296455217 Their comment reads The genome, which was designed based on Genbank Accession Number CP001668 (Mycoplasma mycoides subs. capri str. GM12), was assembled from chemically synthesized oligonucleotides. The sequenced ...

See entire post
by scottie
Thu Sep 13, 2012 1:22 pm
Forum: Evolution
Topic: question for evolutionary biologist.
Replies: 26
Views: 28516

Integrated software tools

... sequence and produce proteins of importance. I'd like to perform tasks using GUI/semi-graphical interfaces, where main formats used are FASTA/GENBANK. UGENE almost fits this description but its focus on projects leads to huge metafiles where all intermediate (and often redundant) steps are ...

See entire post
by dustman
Tue May 08, 2012 12:17 pm
Forum: Molecular Biology
Topic: Integrated software tools
Replies: 4
Views: 2289

Re: I need some actual DNA sequences for a computer program.


See entire post
by wbla3335
Thu Mar 29, 2012 11:38 pm
Forum: Molecular Biology
Topic: I need some actual DNA sequences for a computer program.
Replies: 7
Views: 2889

pairwise alignment results.I need help understanding it pls

... AAAAGTCACATTCTTCGATTA The tomato UBC sequence is the complete CDS which I got from NCBI genbank (825bp), and the arabidopsis UBC gene is the full length cDNA which I got from the TAIR website (621bp). I tried attaching my results as a text ...

See entire post
by yasamino
Sun Oct 16, 2011 2:25 am
Forum: Bioinformatics
Topic: pairwise alignment results.I need help understanding it pls
Replies: 8
Views: 4816
View all matching forum results

This page was last modified 21:16, 3 October 2005. This page has been accessed 3,819 times. 
What links here | Related changes | Permanent link