Dictionary » F » Floats



Origin: oe. Flote ship, boat, fleet, as. Flota ship, fr. Fleotan to float; akin to D. Vloot fleet, g. Floss raft, Icel. Floti float, raft, fleet, Sw. Flotta.

see fleet, and cf. Flotilla, Flotsam, plover.

1. Anything which floats or rests on the surface of a fluid, as to sustain weight, or to indicate the height of the surface, or mark the place of, something. Specifically: a mass of timber or boards fastened together, and conveyed down a stream by the current; a raft.

The hollow, metallic ball of a self-acting faucet, which floats upon the water in a cistern or boiler.

The cork or quill used in angling, to support the bait line, and indicate the bite of a fish.

Anything used to buoy up whatever is liable to sink; an inflated bag or pillow used by persons learning to swim; a life preserver. This reform bill . . . Had been used as a float by the conservative ministry. (j. P. Peters)

2. A float board. See float board (below).

3. A contrivance for affording a copious stream of water to the heated surface of an object of large bulk, as an anvil or die.

4. The act of flowing; flux; flow.

5. A quantity of earth, eighteen feet square and one foot deep.

6. The trowel or f5a

tool with which the floated coat of plastering is leveled and smoothed.

7. A polishing block used in marble working; a runner.

8. A single-cut file for smoothing; a tool used by shoemakers for rasping off pegs inside a shoe.

9. A coal cart.

10. The sea; a wave. See Flote, float board, one of the boards fixed radially to the rim of an undershot water wheel or of a steamer's paddle wheel; a vane. Float case, a siliceous stone used to rub stonework or brickwork to a smooth surface. Float valve, a valve or cock acted upon by a float. See float, 1 (b).

1. To cause to float; to cause to rest or move on the surface of a fluid; as, the tide floated the ship into the harbor. Had floated that bell on the Inchcape rock. (Southey)

2. To flood; to overflow; to cover with water. Proud Pactolus floats the fruitful lands. (Dryden)

3. To pass over and level the surface of with a float while the plastering is kept wet.

4. To support and sustain the credit of, as a commercial scheme or a joint-stock company, so as to enable it to go into, or continue in, operation.

Please contribute to this project, if you have more information about this term feel free to edit this page

Results from our forum

Re: siphonophores

... right biology is awesome! There are roughly 200 spp of Siphonophore the species you mention is Physalia physalis which is the only species that floats, the vast majority swim underwater. 1) The initial zooid arises from a fertilised egg, the rest of the colony is formed by budding which is a ...

See entire post
by fumpledrumpskin
Sun Sep 15, 2013 3:08 pm
Forum: Zoology Discussion
Topic: siphonophores
Replies: 2
Views: 3758

Real Time reverse transcription PCR Questions

... and the site does not match the DNA template strand. If the restriction site does not match with the template does that part just not bind and it floats during the extension round? Does the following look correct? 5' CCTCCATGAGATCCATATGGAG 3' = 5' TCGXXXXXXCCTCCATGAGATCCATATGGAG 3' X= Restriction ...

See entire post
by wessH
Sun Jun 03, 2012 2:21 pm
Forum: Molecular Biology
Topic: Real Time reverse transcription PCR Questions
Replies: 0
Views: 2939

Re: Hard time with homework question

... of water which causes ice to float thus insulating the water below and preventing organisms from freezing. Explain (chemically) why ice floats? I really am grateful for all your help :D

See entire post
by sissyblaze
Mon Nov 21, 2011 9:20 pm
Forum: General Discussion
Topic: Hard time with homework question
Replies: 6
Views: 6126

Re: Alas the creationists are right though...

These kind of changes can happen completely naturally: a tropical storm floats a couple of dozen monitor lizard eggs to Australia and they eat all the kiwis or something like that. I don't want to debate what you have said, although it has been interesting ...

See entire post
by biohazard
Thu Sep 15, 2011 7:49 am
Forum: General Discussion
Topic: Alas the creationists are right though...
Replies: 15
Views: 25455

Re: Alas the creationists are right though...

These kind of changes can happen completely naturally: a tropical storm floats a couple of dozen monitor lizard eggs to Australia and they eat all the kiwis or something like that. I don't want to debate what you have said, although it has been interesting ...

See entire post
by Mrkitagurl
Wed Sep 14, 2011 7:15 am
Forum: General Discussion
Topic: Alas the creationists are right though...
Replies: 15
Views: 25455
View all matching forum results

This page was last modified 21:16, 3 October 2005. This page has been accessed 2,825 times. 
What links here | Related changes | Permanent link