Extension

... units . Any help would be greatly appreciated (even if past the deadline, i would still like to know). Here's the section of text; "Wall extension commonly exhibits a yield threshold stress, below which walls do not extend. Although its molecular nature is not well understood, one way ...

See entire post

... wrong. They believe this for a variety of reasons. The most common reason is childhood indoctrination into their beliefs. Once indoctrinated, the extension of rational thought from everyday life to the big questions is difficult and often impossible for them. Some just like being pests, some think ...

See entire post

... the app automatically fetches the protein sequence from the database and aligns them. Other features of the app: Gap penalties: Open, Affine and Extension penalties Substitution matrices: Blosum60, PAM250, Gonnet250, etc

See entire post

... not match the DNA template strand. If the restriction site does not match with the template does that part just not bind and it floats during the extension round? Does the following look correct? 5' CCTCCATGAGATCCATATGGAG 3' = 5' TCGXXXXXXCCTCCATGAGATCCATATGGAG 3' X= Restriction Site, TCG= extra ...

See entire post

Sulfur amendment is not "organic'" and arguable not green. Here's how one would perform the operation. http://www.extension.org/pages/13046/raising-soil-ph-and-soil-acidification Lowering pH may or may not help - Bruce, do you have any idea what the pH is now? Why do you think ...

See entire post