Dictionary » E » Encoding

Encoding

Encoding

The first stage in the memory process, followed by storage and retrieval, involving processes associated with receiving or briefly registering stimuli through one or more of the senses and modifying that information; a decay process or loss of this information (a type of forgetting) occurs rapidly unless the next two stages, storage and retrieval, are activated.


Please contribute to this project, if you have more information about this term feel free to edit this page



Results from our forum


Re:

... acids, which is usually just referred to as "translation" in biology. This is what Wikipedia is saying they cannot do. They have genes encoding some of this translation equipment, but they don't have enough of such genes to actually sustain translation independently. do ribosomal proteins ...

See entire post
by wildfunguy
Tue Oct 01, 2013 2:04 pm
 
Forum: Microbiology
Topic: Living or not? (viruses,viroids and prions).
Replies: 15
Views: 10396

Data analysis: DNA alignment HELP?

As genes encoding cyclin-dependent kinases had been cloned from Schizosaccharomyces pombe, the fission yeast, Saccharomyces cerevisae, the budding yeast, and human cells, investigators working in plant systems designed experiments ...

See entire post
by TToe
Mon Feb 18, 2013 10:40 am
 
Forum: Genetics
Topic: Data analysis: DNA alignment HELP?
Replies: 1
Views: 1837

cellular mechanisms that result in symptoms of cholera

... production, which in turn leads to secretion of H2O, Na+, K+, Cl−, and HCO3− into the lumen of the small intestine and rapid dehydration. The gene encoding the cholera toxin is introduced into V. cholerae by horizontal gene transfer. Virulent strains of V. cholerae carry a variant of temperate ...

See entire post
by adithya528
Tue Dec 11, 2012 1:49 pm
 
Forum: Cell Biology
Topic: cellular mechanisms that result in symptoms of cholera
Replies: 4
Views: 5043

How do I create the sequence contig of this DNA?

You have the following sequence reads from the protein-encoding region of a Homo sapiens cDNA clone: Read 1: tattatcctgactttagccatgaatatcatgagtacattgcagtgggctgttaactccagcataga Read 2: caaccaaaccatacaagaatggccaactctcgaaagttatgattattgagaattcacacgtg Read ...

See entire post
by TToe
Tue Nov 20, 2012 1:41 pm
 
Forum: Genetics
Topic: How do I create the sequence contig of this DNA?
Replies: 2
Views: 1600

mRNA transcripts, cis/trans-acting questions

... mutation and a GAL80 mutation restores galactose metabolism, and GAL2 is transcribed even when galactose is absent. ______ d. All other enzyme-encoding genes (other than GAL2) in the galactose metabolism pathway are transcribed normally in this mutant. ______ e. The DNA sequence region containing ...

See entire post
by animus31
Fri Nov 09, 2012 11:58 am
 
Forum: Genetics
Topic: mRNA transcripts, cis/trans-acting questions
Replies: 0
Views: 2087
View all matching forum results

This page was last modified 21:16, 3 October 2005. This page has been accessed 9,514 times. 
What links here | Related changes | Permanent link