Encoding

What is the patent for exactly? I'll need a little more info... First, realize I'm only talking about protein encoding genes here (since I think that's what the patent is doing?). Protein encoding genes are simply regions that code for a protein, and non-protein encoding genes ...

See entire post

... membrane. Aldosterone is a steroid, so what it does is to interact with a nuclear receptor that eventually turns on the transcription of a gene encoding a Sodium channel.

See entire post

... back, and I did pretty well, but there was one on there that whacked me between the eyes, here it is... 15.The following DNA sequence shows a gene encoding a small peptide. The promoter region is given in brackets. The three stop codons are UAA, UAG and UGA. 5' (ATGACGTATAA)TGACCGTACATGAGTAATACATAAATCAG ...

See entire post

Ive been given the sequence for a Human Sox4 protein..need to design primers to amplify DNA sequences encoding the HMG box only HMG box : IK RPMNAFMVWS QIERRKIMEQ SPDMHNAEIS KRLGKRWKLL KDSDKIPFIR EAERLRLKHM ADYPDYDYRP Does anyone know how to do this??

See entire post

... wasn't included in the splicing process. it was annotated as a gene, but may not necessarily a gene. although there is no cDNA in the database encoding for the gene, the 123 amino acids are still coded from the exon. :D :D

See entire post