Dictionary » E » Elongation



(Science: radiobiology) parameter indicating the degree to which the cross-section of a toroidal plasma is non-circular. Kappa=b/a, where b and a are the vertical and horizontal minor radii. As kappa is increased, the confinement in relation to the total current improves, but the plasma also becomes more and more unstable to vertical displacements. A circular plasma has kappa of 1, a common value for elongated plasmas is 1.7, and the absolute limit is probably around 2.

Please contribute to this project, if you have more information about this term feel free to edit this page

Results from our forum

principle of error-prone PCR???

... effect on the enzyme. However, Mn stabilizes double stranded DNA and from practical PCR standpoint - excessive magnesium allows for annealing and elongation of mismatched primers.

See entire post
by Cat
Sun Oct 12, 2014 7:39 pm
Forum: Molecular Biology
Topic: principle of error-prone PCR???
Replies: 5
Views: 2529

Annealing Temparature

... anneal the first cycle at 50°C and the rest at 65°C. Denaturation for 10s will be enough, but a bit higher temperature 95-98°C might be better. Elongation depends on polymerase, so 1 min can be enough for Phusion, but 4 min will be required for Pfu.

See entire post
by vladCH
Sat Feb 22, 2014 7:54 pm
Forum: Molecular Biology
Topic: Annealing Temparature
Replies: 4
Views: 2615

Annealing Temparature

... Primer-F : GCTCTAGAGTGATAGTAGGCATGG Primer-R : GCGATATCCTACACCCAAGCTGC I used the following program: 94C 1min 94C 2min 56C 1min 72C 2min final elongation 72C 7min I'm failed to amplify my gene of interest. please help me. :( :( :( :( :(

See entire post
by Helics
Tue Feb 18, 2014 10:49 am
Forum: Molecular Biology
Topic: Annealing Temparature
Replies: 4
Views: 2615

Beetle identification

... the body? The one I saw had a long thin proboscis like a hoverfly that was longer than the body. The norm for this type of beetle is a short thin elongation with feathered antennae on the end, which I can see on your photo. One feature of this type of beetle is that they can cling with remarkable ...

See entire post
by animartco
Wed Jun 05, 2013 1:32 pm
Forum: General Discussion
Topic: Beetle identification
Replies: 1
Views: 2177


... varients,... with 4 different primers... Are you sure that your 2kb fragments is within the cDNA that you created? Did you try to increase the elongation time? Did you try different annealing temperatures?

See entire post
by cathbr
Mon Mar 12, 2012 3:34 pm
Forum: Molecular Biology
Topic: RT-PCR
Replies: 9
Views: 6415
View all matching forum results

This page was last modified 21:16, 3 October 2005. This page has been accessed 26,037 times. 
What links here | Related changes | Permanent link