Answers to all your Biology Questions
|
|
Dictionary » D » Deoxyribose DeoxyriboseDefinition noun (1) An aldopentose (i.e. a monosaccharide with five carbon atoms) derived from the pentose sugar ribose by the replacement of a hydroxyl group with a hydrogen atom at the 2 position, leading to the net loss of an oxygen atom (hence the name). (2) The sugar component in the side chains of DNA, in contrast to the ribose in the side chains of RNA.
Word origin: deoxy + ribose (sugar)
Chemical formula: C6H10O4 Also called:
Compare: ribose Related terms:
Please contribute to this project, if you have more information about this term feel free to edit this page
Results from our forum
Re: Both are nucleic acids containing genetic information with different sugars deoxyribose and ribose sugars RNA is more than 'genetic information'. tRNA, microRNA, ribosomes and so on have plethora of other functions. Only mRNA and genome of some viruses falls ...
See entire post
what is DNA & RNA?Both are nucleic acids containing genetic information with different sugars deoxyribose and ribose sugars
See entire post
RNA as genetic material... RNA is a single-stranded molecule in many of its biological roles and has a much shorter chain of nucleotides. Second, while DNA contains deoxyribose, RNA contains ribose (in deoxyribose there is no hydroxyl group attached to the pentose ring in the 2' position). These hydroxyl groups ...
See entire post
Re: Theories - Origin of Life... The gene remains intact in the structure of the given chromosome. The subunits of the copy are made from a different kind of sugar (not deoxyribose, but ribose), and one of the original organic bases (T) is substituted by another one (U): So the early RNA transcript of the gene is GUUAUCAGUUAAUUGACUCUCGGUAGCCAAGUUGGUUUAAGGCGC ...
See entire post
This page was last modified 22:56, 19 August 2009. This page has been accessed 30,640 times. |
© Biology-Online.org. All Rights Reserved.
Register | Login
| About Us | Contact Us | Link to Us | Disclaimer & Privacy