Dictionary » D » Dandy

Dandy

Dandy

Origin: cf. F. Dandin, ninny, silly fellow, dandiner to waddle, to play the fool; prob. Allied to E. Dandle. Senses 2&3 are of uncertain etymol.

1. One who affects special finery or gives undue attention to dress; a fop; a coxcomb.

2. A sloop or cutter with a jigger on which a lugsail is set. A small sail carried at or near the stern of small boats.

Synonym: jigger, and mizzen.

3. A dandy roller. See below. Dandy brush, a yard whalebone brush. Dandy fever. See dengue. Dandy line, a kind of fishing line to which are attached several crosspieces of whalebone which carry a hook at each end. Dandy roller, a roller sieve used in machines for making paper, to press out water from the pulp, and set the paper.


Please contribute to this project, if you have more information about this term feel free to edit this page



Results from our forum


Re: Human Collembola Infestations

... can when summer comes. In the meantime, go to a tanning booth. Get some exfoliating skin lotion, put it on and go in for 8 minutes. You'll have a dandy sunburn, but they will fry and peel off with the skin. diet: eliminate as many carbs as you can. For a while i ate almost no carbs and it helped ...

See entire post
by stillsuffering
Wed Jan 30, 2008 2:01 am
 
Forum: Human Biology
Topic: Human Collembola Infestations
Replies: 25
Views: 16002

Re: balls

... are off the web and are not morgellons pictures... never said they were... you posted a picture of someone elses hand... where are your pics dandy randy... have you the balls to post any?... do you even have morgellons?... or do you just like being large and in charge?... and, have been a ...

See entire post
by maf
Thu Sep 21, 2006 3:27 am
 
Forum: Human Biology
Topic: The Fiber Disease
Replies: 7403
Views: 749223

The Fiber Disease

... apoptosis, bt endotoxins.....and agriculture...... molecular cloning of nearly all species.....even down to the trees...... Which is all fine and dandy,.....so my children will live in a better world....Yikes, but I don't have any.....so, I'm not very fond of these new scientist....and I'm sure ...

See entire post
by London
Sat Jun 24, 2006 1:38 am
 
Forum: Human Biology
Topic: The Fiber Disease
Replies: 7403
Views: 749223

efficiency of metabolism?

That's all fine and dandy. But what is the question you need to answer?

See entire post
by MrMistery
Sun Nov 27, 2005 8:34 pm
 
Forum: Cell Biology
Topic: efficiency of metabolism?
Replies: 13
Views: 2028

mRNA codon and amino acid

All nice and dandy. Until you get the olympics and you get a question like "What protein sequence will you get from the following DNA generative cathene- ATGCCAGTCAGTAACGTAGCAGATACAGATACAGGGATGACCCAGTAGATGAGAGATGCACAGCATGACTGAC" ...

See entire post
by MrMistery
Thu May 26, 2005 8:06 pm
 
Forum: Genetics
Topic: mRNA codon and amino acid
Replies: 9
Views: 4384


This page was last modified 21:16, 3 October 2005. This page has been accessed 855 times. 
What links here | Related changes | Permanent link