Contig

When you assemble your sequence it looks like you are assembling: under derst rstand anding to get contig = understanding the sequence that does not fit is the reverse complement.

See entire post

... from different genomic clones from one region of the human genome. In the space below the sequences, align the sequences to make a single sequence contig, showing how the sequences overlap. (To make things fit, you may need to write small or wrap around!) NOTE: All six sequences read in a 5’ to ...

See entire post

Look for overlapping sequences. For example, Read 1 begins with tattat. Does this sequence occur in any of the other reads?

See entire post

... Read 7: atttccattttaacaacaggagaaggagaaggaagagttggtattatcctgactttagccatgaa c. Use these 7 sequence reads to create a sequence contig of this portion of the H. sapiens cDNA. Show clearly how you achieved this. I don't understand what's going on, help me to understand what this ...

See entire post

... it should be possible to automate this proces? Eg: if someone sequences an entirely new genome, I can hardly imagine they manually enter each contig in the website and search for it... Are their programs out there to automate this?

See entire post