Dictionary » C » Contig



group of clones representing overlapping regions of the genome.

Please contribute to this project, if you have more information about this term feel free to edit this page

Results from our forum

Population Genetics Questions

When you assemble your sequence it looks like you are assembling: under derst rstand anding to get contig = understanding the sequence that does not fit is the reverse complement.

See entire post
by Cat
Sat Dec 01, 2012 12:05 am
Forum: Genetics
Topic: Population Genetics Questions
Replies: 3
Views: 2492

Population Genetics Questions

... from different genomic clones from one region of the human genome. In the space below the sequences, align the sequences to make a single sequence contig, showing how the sequences overlap. (To make things fit, you may need to write small or wrap around!) NOTE: All six sequences read in a 5’ to ...

See entire post
by animus31
Wed Nov 21, 2012 3:36 pm
Forum: Genetics
Topic: Population Genetics Questions
Replies: 3
Views: 2492

Re: How do I create the sequence contig of this DNA?

Look for overlapping sequences. For example, Read 1 begins with tattat. Does this sequence occur in any of the other reads?

See entire post
by wbla3335
Tue Nov 20, 2012 7:14 pm
Forum: Genetics
Topic: How do I create the sequence contig of this DNA?
Replies: 2
Views: 1665

How do I create the sequence contig of this DNA?

... Read 7: atttccattttaacaacaggagaaggagaaggaagagttggtattatcctgactttagccatgaa c. Use these 7 sequence reads to create a sequence contig of this portion of the H. sapiens cDNA. Show clearly how you achieved this. I don't understand what's going on, help me to understand what this ...

See entire post
by TToe
Tue Nov 20, 2012 1:41 pm
Forum: Genetics
Topic: How do I create the sequence contig of this DNA?
Replies: 2
Views: 1665

searching for gene sequences, automated

... it should be possible to automate this proces? Eg: if someone sequences an entirely new genome, I can hardly imagine they manually enter each contig in the website and search for it... Are their programs out there to automate this?

See entire post
by poloke
Wed Jul 11, 2012 12:58 pm
Forum: Bioinformatics
Topic: searching for gene sequences, automated
Replies: 8
Views: 4158
View all matching forum results

This page was last modified 21:16, 3 October 2005. This page has been accessed 2,370 times. 
What links here | Related changes | Permanent link