Dictionary » C » Complementary sequences

Complementary sequences

Complementary sequence

(Science: molecular biology) Nucleicacid base sequences that can form a double-stranded structure bymatching base pairs, the complementary sequence to G-T-a-C is C-a-T-G.


Please contribute to this project, if you have more information about this term feel free to edit this page



Results from our forum


Re: Any ideas for vaccine development or anti-viral drugs???

... oligomers (PMOs). A combination of EBOV-specific PMOs targeting sequences of viral mRNAs for the viral proteins (VPs) VP24, VP35, and RNA ... infections. Previously we have shown that mice treated with a PMO complementary to a region spanning the start codon of VP24 mRNA were protected ...

See entire post
by jonmoulton
Mon Sep 15, 2014 3:04 pm
 
Forum: Cell Biology
Topic: Any ideas for vaccine development or anti-viral drugs???
Replies: 2
Views: 476

Re: Does complementary DNA include only coding sequences ?

Right - another technique, like RACE, is usually needed to extend the sequence across UTRs. If the primers are designed against genomic sequence, they can include UTR sequence, but are unlikely to capture the entire UTRs.

See entire post
by jonmoulton
Tue Oct 29, 2013 3:14 pm
 
Forum: Genetics
Topic: Does complementary DNA include only coding sequences ?
Replies: 4
Views: 2031

Re: Does complementary DNA include only coding sequences ?

cDNA can contain 5' and/or 3' UTR sequence but not introns.

See entire post
by jonmoulton
Mon Oct 28, 2013 3:46 pm
 
Forum: Genetics
Topic: Does complementary DNA include only coding sequences ?
Replies: 4
Views: 2031

Does complementary DNA include only coding sequences ?

Hello everyone, I was wondering if complementary DNA is a copy of the entire messenger RNA or only a copy of the coding parts ? I'm really confused... For example, if I have the mRNA of a particular gene with some non-coding parts, will the ...

See entire post
by ophelia15
Sat Oct 19, 2013 10:25 pm
 
Forum: Genetics
Topic: Does complementary DNA include only coding sequences ?
Replies: 4
Views: 2031

Population Genetics Questions

... love some guidance. Thanks in advance. 1. You obtain the following sequences from different genomic clones from one region of the human genome. ... so you will need to figure out which one it is and use its reverse complementary strand. Sequence 1: AACAAAAATGTTGTTATTTTTATTTCAGATG Sequence ...

See entire post
by animus31
Wed Nov 21, 2012 3:36 pm
 
Forum: Genetics
Topic: Population Genetics Questions
Replies: 3
Views: 2489
View all matching forum results

This page was last modified 21:16, 3 October 2005. This page has been accessed 5,678 times. 
What links here | Related changes | Permanent link