Dictionary » C » Cga

Cga

Cga

(Science: abbreviation) catabolite gene activator.


Please contribute to this project, if you have more information about this term feel free to edit this page



Results from our forum


Re: Codons are triplets, but what's a Singlet, Doublet, etc?

... TTG 17 101 CAC GTG GTG 18 102 CAG GTC CTG 19 103 CAT GTA ATG 20 110 CCA GGT TGG 21 111 CCC GGG GGG 22 112 CCG GGC CGG 23 113 CCT GGA AGG 24 120 CGA GCT TCG 25 121 CGC GCG GCG 26 122 CGG GCC CCG 27 123 CGT GCA ACG 28 130 CTA GAT TAG 29 131 CTC GAG GAG 30 132 CTG GAC CAG 31 133 CTT GAA AAG 32 ...

See entire post
by GaryGaulin
Mon Oct 29, 2012 7:18 am
 
Forum: Bioinformatics
Topic: Codons are triplets, but what's a Singlet, Doublet, etc?
Replies: 4
Views: 11037

PCR KIT

... i request from amplify 16s rRNA.? i will try to use these primers Forward “5’-AGA GTT TGA TCC TGG CTC AG-3’ ” and, Reverse “5’-ACG GCT ACC TTG TTA CGA CTT-3’ ” please if anyone has an idea plz help me and if anyone has a recommendation about the primer plz tell me. Best Regards

See entire post
by Nmr
Sat Apr 02, 2011 4:22 pm
 
Forum: Molecular Biology
Topic: PCR KIT
Replies: 0
Views: 573

Molecular Genetics Questions!

8. the recognized sequence is: 5'-A'AGCTT-3' 3'-TTCGA'A-5' after cut: A...AGCTT TTCGA...A after "filling"with DNA Pol AAGCTT...AAGCTT TTCGAA...TTCGAA and ligate AAGCTTAAGCTT TTCGAATTCGAA is there any new cut site? 9. EcoRV cuts GAT'ATC and ...

See entire post
by JackBean
Wed Jan 26, 2011 10:04 pm
 
Forum: Genetics
Topic: Molecular Genetics Questions!
Replies: 1
Views: 1530

Re: HELP! translate the piece of mRNA

your sequence: CGAAUGCCAGCAGGCUCCCCUCAU first, find the START codon (ATG for DNA): CGA AUG CCAGCAGGCUCCCCUCAU now, divide the triplets: CGA AUG CCA GCA GGC UCC CCU CAU asign amino acid to each triplet up to any STOP codon in frame. ...

See entire post
by JackBean
Wed Dec 01, 2010 3:01 pm
 
Forum: Genetics
Topic: HELP! translate the piece of mRNA
Replies: 3
Views: 1620

Need help with translation of DNA

... into a protein. I understand how the whole process works, but I think my teacher threw us a curve. The mRNA strand was AUG AAG AUG .... UGA UGU CGA UGA The ... represents a bunch of mRNA that coded to amino acids, but my question revolves around the two ends. If there are two methionine (MET), ...

See entire post
by customx
Thu Jul 29, 2010 10:26 pm
 
Forum: General Discussion
Topic: Need help with translation of DNA
Replies: 3
Views: 2059
View all matching forum results

This page was last modified 21:16, 3 October 2005. This page has been accessed 1,311 times. 
What links here | Related changes | Permanent link