Dictionary » C » Ccu



(Science: abbreviation) coronary care unit; critical care unit.

Please contribute to this project, if you have more information about this term feel free to edit this page

Results from our forum

Re: HELP! translate the piece of mRNA

your sequence: CGAAUGCCAGCAGGCUCCCCUCAU first, find the START codon (ATG for DNA): CGA AUG CCAGCAGGCUCCCCUCAU now, divide the triplets: CGA AUG CCA GCA GGC UCC CCU CAU asign amino acid to each triplet up to any STOP codon in frame. Choose ...

See entire post
by JackBean
Wed Dec 01, 2010 3:01 pm
Forum: Genetics
Topic: HELP! translate the piece of mRNA
Replies: 3
Views: 1524

Re: Help with protein synthesis problem

... but this way comes up with the "correct" answer you were given. DNA – 5’-TAC GGA TTC AGA-3’ mRNA – 5'-UAC GGA UUC AGA-3' anti’s – 3’-AUG CCU AAG UCU-5’

See entire post
by blcr11
Sat Feb 02, 2008 12:56 pm
Forum: Molecular Biology
Topic: Help with protein synthesis problem
Replies: 1
Views: 2590

Help with protein synthesis problem

... of DNA: 3' TAC GGA TTC AGA 5' the sequence of anticodons of RNAr and corresponding to the RNAt originated from this segment is: the answer: AUG CCU AAG UCU So, I don't get it because that answer seems to me that is the RNAm and not the RNAt. I think it must be UAC GGA UUC AGA by the way, why ...

See entire post
by rdpioneer
Sat Feb 02, 2008 12:41 am
Forum: Molecular Biology
Topic: Help with protein synthesis problem
Replies: 1
Views: 2590

This page was last modified 21:16, 3 October 2005. This page has been accessed 986 times. 
What links here | Related changes | Permanent link