Ccu

your sequence: CGAAUGCCAGCAGGCUCCCCUCAU first, find the START codon (ATG for DNA): CGA AUG CCAGCAGGCUCCCCUCAU now, divide the triplets: CGA AUG CCA GCA GGC UCC CCU CAU asign amino acid to each triplet up to any STOP codon in frame. Choose ...

See entire post

... but this way comes up with the "correct" answer you were given. DNA – 5’-TAC GGA TTC AGA-3’ mRNA – 5'-UAC GGA UUC AGA-3' anti’s – 3’-AUG CCU AAG UCU-5’

See entire post

... of DNA: 3' TAC GGA TTC AGA 5' the sequence of anticodons of RNAr and corresponding to the RNAt originated from this segment is: the answer: AUG CCU AAG UCU So, I don't get it because that answer seems to me that is the RNAm and not the RNAt. I think it must be UAC GGA UUC AGA by the way, why ...

See entire post