Dictionary » C » Cca



(Science: abbreviation) chimpanzee coryza agent.

Please contribute to this project, if you have more information about this term feel free to edit this page

Results from our forum

Promoter PCR primer set problem

... of the promoter region of my gene of interest. fw: 5'- gggg CCGCGG TG AGC AAG TAT ACC AAC CAT -3' (Sacii) Tm 63.3 rv: 5'- gggg TCTAGA CAA TGT ACA CCA ACA TAT AC -3' (Xbai) Tm 56.5 I am using genomic DNA as template and KOD kit. Unfortunately I have been unsuccessful in amplifying the target region. ...

See entire post
by bravebeaker
Tue Jul 09, 2013 3:05 am
Forum: Molecular Biology
Topic: Promoter PCR primer set problem
Replies: 2
Views: 2280

Re: Codons are triplets, but what's a Singlet, Doublet, etc?

... TAT 13 031 ATC TAG GAT 14 032 ATG TAC CAT 15 033 ATT TAA AAT 16 100 CAA GTT TTG 17 101 CAC GTG GTG 18 102 CAG GTC CTG 19 103 CAT GTA ATG 20 110 CCA GGT TGG 21 111 CCC GGG GGG 22 112 CCG GGC CGG 23 113 CCT GGA AGG 24 120 CGA GCT TCG 25 121 CGC GCG GCG 26 122 CGG GCC CCG 27 123 CGT GCA ACG 28 ...

See entire post
by GaryGaulin
Mon Oct 29, 2012 7:18 am
Forum: Bioinformatics
Topic: Codons are triplets, but what's a Singlet, Doublet, etc?
Replies: 4
Views: 11314


I need help. I design primer for PCR: Forward primer: at cag tCC ATG gga aca ggc tca caa g [CCATGG is NcoI restriction site] Reverse primer: tat GTCGACTTA TTC GTG CCA TTC GAT TTT CTG AGC CTC GAA GAT GTC GTT CAG ACC GCC ACC CCA AAT GGC TCC C [GTCGAC is SalI restriction ...

See entire post
by akane19861020
Thu Dec 15, 2011 9:39 am
Forum: Molecular Biology
Topic: PCR
Replies: 3
Views: 1348

ordination dilemma

... The sample size is quite large (over 1000 cases). What would be the best way of finding correlations between species and E-variables? I applied CCA but have doubts for as I remember, E-variables should be quantitative if we want to assess the strength of the correlation between a species and ...

See entire post
by andybobby
Mon Jan 10, 2011 11:55 am
Forum: Ecology
Topic: ordination dilemma
Replies: 0
Views: 1338

Re: HELP! translate the piece of mRNA

your sequence: CGAAUGCCAGCAGGCUCCCCUCAU first, find the START codon (ATG for DNA): CGA AUG CCAGCAGGCUCCCCUCAU now, divide the triplets: CGA AUG CCA GCA GGC UCC CCU CAU asign amino acid to each triplet up to any STOP codon in frame. ...

See entire post
by JackBean
Wed Dec 01, 2010 3:01 pm
Forum: Genetics
Topic: HELP! translate the piece of mRNA
Replies: 3
Views: 1631
View all matching forum results

This page was last modified 21:16, 3 October 2005. This page has been accessed 2,082 times. 
What links here | Related changes | Permanent link