Dictionary » B » Brackets

Brackets

Bracket

(Science: dentistry) a metal or ceramic part that is glued onto a tooth and serves as a means of fastening the arch wire.


Please contribute to this project, if you have more information about this term feel free to edit this page



Results from our forum


Tricky translation question, can someone help please?

... whacked me between the eyes, here it is... 15.The following DNA sequence shows a gene encoding a small peptide. The promoter region is given in brackets. The three stop codons are UAA, UAG and UGA. 5' (ATGACGTATAA)TGACCGTACATGAGTAATACATAAATCAG 3' 3' (TACTGCATATT)ACTGGCATGTACTCATTATGTATTTAGTC ...

See entire post
by 0rion
Mon Jun 15, 2009 5:35 pm
 
Forum: Molecular Biology
Topic: Tricky translation question, can someone help please?
Replies: 1
Views: 131

Re: Natural selection is proven wrong

... according to NS should be rare To make things simple, you do not understand what you are quoting. The part that should be bolded is what is in brackets, the definition of helpful (and by opposition of harmful). In fact a gene that would cause you an incredibly painful and slow death but will ...

See entire post
by canalon
Thu Apr 23, 2009 2:02 pm
 
Forum: Evolution
Topic: Natural selection is proven wrong
Replies: 177
Views: 16556

Evolution

... - can you see that? The wording of that question about diversity between the populations that have no gene flow is terrible! Given the parts in brackets (or parentheses lol) then of course it increases the diversity as the two populations become less similar...yeh?

See entire post
by kotoreru
Fri Sep 28, 2007 10:30 am
 
Forum: Genetics
Topic: Evolution
Replies: 4
Views: 713

Meiosis/Mitosis questions

Hi guys, these are just basic true false questions. I've written in brackets what I think the answer is... 1. Homologous chromosomes pair in meiosis but not mitosis. (I think True) 2. Following both mitosis and the first division of meiosis, each of the daughter ...

See entire post
by take_no_prisoners
Sat Apr 07, 2007 5:25 am
 
Forum: Cell Biology
Topic: Meiosis/Mitosis questions
Replies: 10
Views: 1851

Animalia

... IS it the same thing happens in moss and fern's "metagenesis"... Well I don't think so :? @Amrik: Why do you put "women" in brackets? Blastula and gastrula are common in human, even all animals development :?

See entire post
by Dr.Stein
Sat Oct 14, 2006 3:54 am
 
Forum: Zoology Discussion
Topic: Animalia
Replies: 11
Views: 1276
View all matching forum results

This page was last modified 21:16, 3 October 2005. This page has been accessed 637 times. 
What links here | Related changes | Permanent link