Brackets

... whacked me between the eyes, here it is... 15.The following DNA sequence shows a gene encoding a small peptide. The promoter region is given in brackets. The three stop codons are UAA, UAG and UGA. 5' (ATGACGTATAA)TGACCGTACATGAGTAATACATAAATCAG 3' 3' (TACTGCATATT)ACTGGCATGTACTCATTATGTATTTAGTC ...

See entire post

... according to NS should be rare To make things simple, you do not understand what you are quoting. The part that should be bolded is what is in brackets, the definition of helpful (and by opposition of harmful). In fact a gene that would cause you an incredibly painful and slow death but will ...

See entire post

... - can you see that? The wording of that question about diversity between the populations that have no gene flow is terrible! Given the parts in brackets (or parentheses lol) then of course it increases the diversity as the two populations become less similar...yeh?

See entire post

Hi guys, these are just basic true false questions. I've written in brackets what I think the answer is... 1. Homologous chromosomes pair in meiosis but not mitosis. (I think True) 2. Following both mitosis and the first division of meiosis, each of the daughter ...

See entire post

... IS it the same thing happens in moss and fern's "metagenesis"... Well I don't think so :? @Amrik: Why do you put "women" in brackets? Blastula and gastrula are common in human, even all animals development :?

See entire post