Antisense strand

For this mRNA: AAGGGUGUAGAAGCUAAGGGU The antisense is likely: ACCCTTAGCTTCTACACCCTT The sense is likely: AAGGGTGTAGAAGCTAAGGGT ... be a pre-mRNA splicing event within the sequence that produces the mature mRNA strand. If so, the DNA sequence would be interrupted by an intron. If there is no ...

See entire post

... an oligo into cells, such as one of the following: RNase-H competent antisense -- ssDNA oligos ssRNA oligos Phosphorothioate oligos Many sorts ... RNA that are recognized by the enzyme RNase-H, which cleaves the RNA strand. RNase-independent oligos bind to the mRNA and get in the way of processes; ...

See entire post

... questions: The following DNA sequence is found in a segment of double-stranded DNA that encodes for the English word describing protein that is ... word for this protein? Be sure to note the 5' and 3' ends. What is the antisense DNA sequence that would be found in the template strand for the ...

See entire post

Hi! I want to run a strandspecific PCR. I have sense and antisense RNA transcript as control. How would you do it? The simpliest would be just to use one primer for ...

See entire post

... polyA tail, I turn that into cDNA...is the newly made cDNA the sense or antisense strand?...man I have found definitions (inc. this site) of the meaning of these 2 strands but ...

See entire post