Dictionary » A » Annealing

Annealing

Annealing

1. Toughening upon slow cooling.

2. Used in the context of dna renaturation after temperature dissociation of the two strands. Rate of annealing is a function of complementarity.

3. Fusion of microtubules or microfilaments end to end.


Please contribute to this project, if you have more information about this term feel free to edit this page



Results from our forum


Re: Annealing Temparature

Primer_F: 5'-GCTCTAGAGTGATAGTGAGCATGG-3' Primer_R: 5'-GCGATATCCTACACCCAAGCTGC-3' CORRECTED PRIMER SEQUENCE. THANKS ALL. I WILL TRY SUGGESTED EXP. CONDITION. THANKS "vladCH".

See entire post
by Helics
Sun Feb 23, 2014 4:59 pm
 
Forum: Molecular Biology
Topic: Annealing Temparature
Replies: 4
Views: 350

Annealing Temparature

... your denaturation in the beginning is only 1 min or is it a typo? Why do you have such long denaturation during cycling? Why do you have such long annealing? What polymerase do you use? What is the GC content of your GOI? How many cycles did you have? What is the template? What concentration did ...

See entire post
by JackBean
Tue Feb 18, 2014 12:40 pm
 
Forum: Molecular Biology
Topic: Annealing Temparature
Replies: 4
Views: 350

Annealing Temparature

My Gene of Interest is 2kb long Primer-F : GCTCTAGAGTGATAGTAGGCATGG Primer-R : GCGATATCCTACACCCAAGCTGC I used the following program: 94C 1min 94C 2min 56C 1min 72C 2min final elongation 72C 7min I'm failed to amplify my gene of interest. please help me. :( :( :( :( :(

See entire post
by Helics
Tue Feb 18, 2014 10:49 am
 
Forum: Molecular Biology
Topic: Annealing Temparature
Replies: 4
Views: 350

Promoter PCR primer set problem

... Tm 56.5 I am using genomic DNA as template and KOD kit. Unfortunately I have been unsuccessful in amplifying the target region. I have tried many annealing temperatures such as 50 up to 60. Any idea how to solve this problem? If the primers are of no use, how can I redesign them? I need the SacII ...

See entire post
by bravebeaker
Tue Jul 09, 2013 3:05 am
 
Forum: Molecular Biology
Topic: Promoter PCR primer set problem
Replies: 2
Views: 1897

Why would the identical amino acids region of certain specie

Because if the amino acids are identical, the DNA sequences are probably also very similar (but does not have to be identical!), thus primer annealing to this region may be used for several species. It can be used either as unspecific primer for known species or it can be used even for so far ...

See entire post
by JackBean
Mon Feb 18, 2013 1:06 pm
 
Forum: Genetics
Topic: Why would the identical amino acids region of certain specie
Replies: 2
Views: 2096
View all matching forum results

This page was last modified 21:16, 3 October 2005. This page has been accessed 4,047 times. 
What links here | Related changes | Permanent link