Dictionary » A » Annealing

Annealing

Annealing

1. Toughening upon slow cooling.

2. Used in the context of dna renaturation after temperature dissociation of the two strands. Rate of annealing is a function of complementarity.

3. Fusion of microtubules or microfilaments end to end.


Please contribute to this project, if you have more information about this term feel free to edit this page



Results from our forum


Taqman probe design using FISH probe (need help)

... in combination with other two oligonucleotides. the size of the amplicon is very small, usually < 200 bp. here, the hydrolysis probe has an annealing temperature such that it will remain hybridized at PCR extension temperature (but not so high as a fish probe) and will be hydrolysed by Taq ...

See entire post
by protoemics
Wed Feb 04, 2015 8:11 am
 
Forum: Bioinformatics
Topic: Taqman probe design using FISH probe (need help)
Replies: 2
Views: 543

principle of error-prone PCR???

... know about the effect on the enzyme. However, Mn stabilizes double stranded DNA and from practical PCR standpoint - excessive magnesium allows for annealing and elongation of mismatched primers.

See entire post
by Cat
Sun Oct 12, 2014 7:39 pm
 
Forum: Molecular Biology
Topic: principle of error-prone PCR???
Replies: 5
Views: 2481

Re: Annealing Temparature

Primer_F: 5'-GCTCTAGAGTGATAGTGAGCATGG-3' Primer_R: 5'-GCGATATCCTACACCCAAGCTGC-3' CORRECTED PRIMER SEQUENCE. THANKS ALL. I WILL TRY SUGGESTED EXP. CONDITION. THANKS "vladCH".

See entire post
by Helics
Sun Feb 23, 2014 4:59 pm
 
Forum: Molecular Biology
Topic: Annealing Temparature
Replies: 4
Views: 2579

Annealing Temparature

... your denaturation in the beginning is only 1 min or is it a typo? Why do you have such long denaturation during cycling? Why do you have such long annealing? What polymerase do you use? What is the GC content of your GOI? How many cycles did you have? What is the template? What concentration did ...

See entire post
by JackBean
Tue Feb 18, 2014 12:40 pm
 
Forum: Molecular Biology
Topic: Annealing Temparature
Replies: 4
Views: 2579

Annealing Temparature

My Gene of Interest is 2kb long Primer-F : GCTCTAGAGTGATAGTAGGCATGG Primer-R : GCGATATCCTACACCCAAGCTGC I used the following program: 94C 1min 94C 2min 56C 1min 72C 2min final elongation 72C 7min I'm failed to amplify my gene of interest. please help me. :( :( :( :( :(

See entire post
by Helics
Tue Feb 18, 2014 10:49 am
 
Forum: Molecular Biology
Topic: Annealing Temparature
Replies: 4
Views: 2579
View all matching forum results

This page was last modified 21:16, 3 October 2005. This page has been accessed 5,444 times. 
What links here | Related changes | Permanent link