Dictionary » A » Amplify

Amplify

Definition

verb

(1) To increase in number, effect, size, volume, amplitude of, etc.

(2) To make larger, greater, stronger; to enlarge.

(3) To exaggerate.


Supplement

Word origin: late ME amplifyen < MF amplifier < L amplific─üre (to increase, augment).


Related forms: amplifies (verb: simple present), amplified (verb: simple past), amplifying (verb: present participle), amplification (noun), amplifier (noun).

Related term: gene amplification


Please contribute to this project, if you have more information about this term feel free to edit this page



Results from our forum


Re: An interesting PCR smearing...I dont know what to do :(

hello all , Even i have a similar problem. I am using 3 different primers to amplify 3 different exons of a gene . 1 of the exon is amplifying very well ( a single bright band ) but the other two exon amplification is not coming properly.and this has occured recently. ...

See entire post
by priyah
Sat Jun 28, 2014 5:20 pm
 
Forum: Molecular Biology
Topic: An interesting PCR smearing...I dont know what to do :(
Replies: 9
Views: 6811

Annealing Temparature

According to NCBI this pair should not amplify anything anyway...

See entire post
by Cat
Fri Feb 21, 2014 1:14 am
 
Forum: Molecular Biology
Topic: Annealing Temparature
Replies: 4
Views: 1577

Annealing Temparature

... Primer-R : GCGATATCCTACACCCAAGCTGC I used the following program: 94C 1min 94C 2min 56C 1min 72C 2min final elongation 72C 7min I'm failed to amplify my gene of interest. please help me. :( :( :( :( :(

See entire post
by Helics
Tue Feb 18, 2014 10:49 am
 
Forum: Molecular Biology
Topic: Annealing Temparature
Replies: 4
Views: 1577

mRNA Search for RT-PCR (U to T)

Because first you synthesise 1st strand and then use the primers to amplify your gene.

See entire post
by JackBean
Fri Jan 24, 2014 12:58 pm
 
Forum: Molecular Biology
Topic: mRNA Search for RT-PCR (U to T)
Replies: 8
Views: 5343

A question regarding PCR

... your microsatellite is part of the chromosome, right? So there will be much more than 7 bp and it will be on both sides. Yes, the polymerase will amplify the chain until the conditions change (i.e. end of amplification step) or until it falls off (which may happen with very long amplicons, that's ...

See entire post
by JackBean
Sat Jan 18, 2014 2:36 pm
 
Forum: Molecular Biology
Topic: A question regarding PCR
Replies: 1
Views: 1458
View all matching forum results

This page was last modified 09:18, 10 December 2008. This page has been accessed 4,088 times. 
What links here | Related changes | Permanent link